ID: 984579040

View in Genome Browser
Species Human (GRCh38)
Location 4:181488433-181488455
Sequence GTGAACATCACCTCTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984579032_984579040 22 Left 984579032 4:181488388-181488410 CCTCCTGATTTCTCATCTCTGTG No data
Right 984579040 4:181488433-181488455 GTGAACATCACCTCTTTCTCTGG No data
984579035_984579040 19 Left 984579035 4:181488391-181488413 CCTGATTTCTCATCTCTGTGGGG No data
Right 984579040 4:181488433-181488455 GTGAACATCACCTCTTTCTCTGG No data
984579031_984579040 23 Left 984579031 4:181488387-181488409 CCCTCCTGATTTCTCATCTCTGT No data
Right 984579040 4:181488433-181488455 GTGAACATCACCTCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984579040 Original CRISPR GTGAACATCACCTCTTTCTC TGG Intergenic
No off target data available for this crispr