ID: 984580908

View in Genome Browser
Species Human (GRCh38)
Location 4:181509078-181509100
Sequence TCCCTATGATCTCGGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984580908_984580913 3 Left 984580908 4:181509078-181509100 CCTGCAACCCGAGATCATAGGGA No data
Right 984580913 4:181509104-181509126 AAGAAACTACACGTGGAACATGG No data
984580908_984580914 28 Left 984580908 4:181509078-181509100 CCTGCAACCCGAGATCATAGGGA No data
Right 984580914 4:181509129-181509151 CTTTCACTTACTCTAAGCAAAGG No data
984580908_984580912 -4 Left 984580908 4:181509078-181509100 CCTGCAACCCGAGATCATAGGGA No data
Right 984580912 4:181509097-181509119 GGGAGGAAAGAAACTACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984580908 Original CRISPR TCCCTATGATCTCGGGTTGC AGG (reversed) Intergenic
No off target data available for this crispr