ID: 984585101

View in Genome Browser
Species Human (GRCh38)
Location 4:181554254-181554276
Sequence CACCGCCCGCAGCTTTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984585101 Original CRISPR CACCGCCCGCAGCTTTTCAG TGG (reversed) Intergenic
No off target data available for this crispr