ID: 984588129

View in Genome Browser
Species Human (GRCh38)
Location 4:181586508-181586530
Sequence CACTTGAACTGGGATTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984588129_984588139 18 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588139 4:181586549-181586571 CAAAACCAAAGGGCCAGGTGCGG No data
984588129_984588136 8 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588136 4:181586539-181586561 CCCTTAAAAACAAAACCAAAGGG No data
984588129_984588134 7 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588134 4:181586538-181586560 TCCCTTAAAAACAAAACCAAAGG No data
984588129_984588138 13 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588138 4:181586544-181586566 AAAAACAAAACCAAAGGGCCAGG No data
984588129_984588140 21 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588140 4:181586552-181586574 AACCAAAGGGCCAGGTGCGGTGG 0: 2
1: 3
2: 97
3: 910
4: 5320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984588129 Original CRISPR CACTTGAACTGGGATTTGAA TGG (reversed) Intergenic
No off target data available for this crispr