ID: 984588133

View in Genome Browser
Species Human (GRCh38)
Location 4:181586519-181586541
Sequence GGGAACTCCACCACTTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984588133_984588136 -3 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588136 4:181586539-181586561 CCCTTAAAAACAAAACCAAAGGG No data
984588133_984588139 7 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588139 4:181586549-181586571 CAAAACCAAAGGGCCAGGTGCGG No data
984588133_984588134 -4 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588134 4:181586538-181586560 TCCCTTAAAAACAAAACCAAAGG No data
984588133_984588140 10 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588140 4:181586552-181586574 AACCAAAGGGCCAGGTGCGGTGG 0: 2
1: 3
2: 97
3: 910
4: 5320
984588133_984588138 2 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588138 4:181586544-181586566 AAAAACAAAACCAAAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984588133 Original CRISPR GGGAACTCCACCACTTGAAC TGG (reversed) Intergenic
No off target data available for this crispr