ID: 984588134

View in Genome Browser
Species Human (GRCh38)
Location 4:181586538-181586560
Sequence TCCCTTAAAAACAAAACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984588129_984588134 7 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588134 4:181586538-181586560 TCCCTTAAAAACAAAACCAAAGG No data
984588132_984588134 -3 Left 984588132 4:181586518-181586540 CCCAGTTCAAGTGGTGGAGTTCC No data
Right 984588134 4:181586538-181586560 TCCCTTAAAAACAAAACCAAAGG No data
984588133_984588134 -4 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588134 4:181586538-181586560 TCCCTTAAAAACAAAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984588134 Original CRISPR TCCCTTAAAAACAAAACCAA AGG Intergenic
No off target data available for this crispr