ID: 984588136

View in Genome Browser
Species Human (GRCh38)
Location 4:181586539-181586561
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984588133_984588136 -3 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588136 4:181586539-181586561 CCCTTAAAAACAAAACCAAAGGG No data
984588129_984588136 8 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588136 4:181586539-181586561 CCCTTAAAAACAAAACCAAAGGG No data
984588132_984588136 -2 Left 984588132 4:181586518-181586540 CCCAGTTCAAGTGGTGGAGTTCC No data
Right 984588136 4:181586539-181586561 CCCTTAAAAACAAAACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type