ID: 984588139

View in Genome Browser
Species Human (GRCh38)
Location 4:181586549-181586571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984588133_984588139 7 Left 984588133 4:181586519-181586541 CCAGTTCAAGTGGTGGAGTTCCC No data
Right 984588139 4:181586549-181586571 CAAAACCAAAGGGCCAGGTGCGG No data
984588129_984588139 18 Left 984588129 4:181586508-181586530 CCATTCAAATCCCAGTTCAAGTG No data
Right 984588139 4:181586549-181586571 CAAAACCAAAGGGCCAGGTGCGG No data
984588132_984588139 8 Left 984588132 4:181586518-181586540 CCCAGTTCAAGTGGTGGAGTTCC No data
Right 984588139 4:181586549-181586571 CAAAACCAAAGGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type