ID: 984588533

View in Genome Browser
Species Human (GRCh38)
Location 4:181590391-181590413
Sequence CTGTGACTGGGTAGGTAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984588533_984588540 28 Left 984588533 4:181590391-181590413 CCGATTTACCTACCCAGTCACAG No data
Right 984588540 4:181590442-181590464 GCAGGTCTGTGCCAAGAGCCAGG No data
984588533_984588538 -10 Left 984588533 4:181590391-181590413 CCGATTTACCTACCCAGTCACAG No data
Right 984588538 4:181590404-181590426 CCAGTCACAGATGGTCATCTTGG No data
984588533_984588539 10 Left 984588533 4:181590391-181590413 CCGATTTACCTACCCAGTCACAG No data
Right 984588539 4:181590424-181590446 TGGAACAGAAAGTGAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984588533 Original CRISPR CTGTGACTGGGTAGGTAAAT CGG (reversed) Intergenic
No off target data available for this crispr