ID: 984590818

View in Genome Browser
Species Human (GRCh38)
Location 4:181615652-181615674
Sequence TCTAAGCATTAGTAGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984590818_984590821 22 Left 984590818 4:181615652-181615674 CCGTGCTCCTACTAATGCTTAGA No data
Right 984590821 4:181615697-181615719 AATACAGTATTAATTCTGCAAGG No data
984590818_984590823 30 Left 984590818 4:181615652-181615674 CCGTGCTCCTACTAATGCTTAGA No data
Right 984590823 4:181615705-181615727 ATTAATTCTGCAAGGTCAGAGGG No data
984590818_984590822 29 Left 984590818 4:181615652-181615674 CCGTGCTCCTACTAATGCTTAGA No data
Right 984590822 4:181615704-181615726 TATTAATTCTGCAAGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984590818 Original CRISPR TCTAAGCATTAGTAGGAGCA CGG (reversed) Intergenic
No off target data available for this crispr