ID: 984592755

View in Genome Browser
Species Human (GRCh38)
Location 4:181635141-181635163
Sequence CTGCATCAGCAGCAGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984592752_984592755 -8 Left 984592752 4:181635126-181635148 CCGTCAAAATTTTCTCTGCATCA No data
Right 984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984592755 Original CRISPR CTGCATCAGCAGCAGAAGGG AGG Intergenic
No off target data available for this crispr