ID: 984601828

View in Genome Browser
Species Human (GRCh38)
Location 4:181736665-181736687
Sequence CTAGTTGAGGCCAGGATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984601828_984601832 16 Left 984601828 4:181736665-181736687 CCAATAATCCTGGCCTCAACTAG No data
Right 984601832 4:181736704-181736726 GAACAAATTAAAATTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984601828 Original CRISPR CTAGTTGAGGCCAGGATTAT TGG (reversed) Intergenic
No off target data available for this crispr