ID: 984601832

View in Genome Browser
Species Human (GRCh38)
Location 4:181736704-181736726
Sequence GAACAAATTAAAATTTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984601831_984601832 3 Left 984601831 4:181736678-181736700 CCTCAACTAGGTTATTTTTAAAT No data
Right 984601832 4:181736704-181736726 GAACAAATTAAAATTTGAATTGG No data
984601825_984601832 26 Left 984601825 4:181736655-181736677 CCATTAAAACCCAATAATCCTGG No data
Right 984601832 4:181736704-181736726 GAACAAATTAAAATTTGAATTGG No data
984601828_984601832 16 Left 984601828 4:181736665-181736687 CCAATAATCCTGGCCTCAACTAG No data
Right 984601832 4:181736704-181736726 GAACAAATTAAAATTTGAATTGG No data
984601830_984601832 8 Left 984601830 4:181736673-181736695 CCTGGCCTCAACTAGGTTATTTT No data
Right 984601832 4:181736704-181736726 GAACAAATTAAAATTTGAATTGG No data
984601827_984601832 17 Left 984601827 4:181736664-181736686 CCCAATAATCCTGGCCTCAACTA No data
Right 984601832 4:181736704-181736726 GAACAAATTAAAATTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984601832 Original CRISPR GAACAAATTAAAATTTGAAT TGG Intergenic
No off target data available for this crispr