ID: 984608555

View in Genome Browser
Species Human (GRCh38)
Location 4:181812667-181812689
Sequence GGCTCGGAGGACAGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984608551_984608555 24 Left 984608551 4:181812620-181812642 CCAGTAAATGCTGCGCTTGCAGA No data
Right 984608555 4:181812667-181812689 GGCTCGGAGGACAGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984608555 Original CRISPR GGCTCGGAGGACAGCTGAGC TGG Intergenic