ID: 984609289

View in Genome Browser
Species Human (GRCh38)
Location 4:181819594-181819616
Sequence AATTTTCCACAGATGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984609283_984609289 12 Left 984609283 4:181819559-181819581 CCTTTTTGGCACCAGGGACTGGT 0: 487
1: 806
2: 1199
3: 1099
4: 765
Right 984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG No data
984609285_984609289 1 Left 984609285 4:181819570-181819592 CCAGGGACTGGTTTCATGGAAGA 0: 325
1: 560
2: 1171
3: 1237
4: 1212
Right 984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984609289 Original CRISPR AATTTTCCACAGATGGAGGG TGG Intergenic
No off target data available for this crispr