ID: 984617284

View in Genome Browser
Species Human (GRCh38)
Location 4:181913200-181913222
Sequence ACGCAGAAGCCGAGACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984617280_984617284 25 Left 984617280 4:181913152-181913174 CCAATGCGGGAATGAAATAGTGA No data
Right 984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984617284 Original CRISPR ACGCAGAAGCCGAGACAGGA AGG Intergenic
No off target data available for this crispr