ID: 984617537

View in Genome Browser
Species Human (GRCh38)
Location 4:181915644-181915666
Sequence GAGGAGAAGCAGAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984617530_984617537 9 Left 984617530 4:181915612-181915634 CCATCAGAAAGAAAGGAATGCAA No data
Right 984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984617537 Original CRISPR GAGGAGAAGCAGAGAGGGGA GGG Intergenic
No off target data available for this crispr