ID: 984621721

View in Genome Browser
Species Human (GRCh38)
Location 4:181960917-181960939
Sequence CACAGAGCTGTGTGATCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984621721_984621722 1 Left 984621721 4:181960917-181960939 CCGGCTGATCACACAGCTCTGTG No data
Right 984621722 4:181960941-181960963 CAGCCATTGCAGATTGCTAATGG No data
984621721_984621726 26 Left 984621721 4:181960917-181960939 CCGGCTGATCACACAGCTCTGTG No data
Right 984621726 4:181960966-181960988 ACCCTGCACTAGGGAATAGATGG No data
984621721_984621725 17 Left 984621721 4:181960917-181960939 CCGGCTGATCACACAGCTCTGTG No data
Right 984621725 4:181960957-181960979 CTAATGGTAACCCTGCACTAGGG No data
984621721_984621724 16 Left 984621721 4:181960917-181960939 CCGGCTGATCACACAGCTCTGTG No data
Right 984621724 4:181960956-181960978 GCTAATGGTAACCCTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984621721 Original CRISPR CACAGAGCTGTGTGATCAGC CGG (reversed) Intergenic
No off target data available for this crispr