ID: 984622004

View in Genome Browser
Species Human (GRCh38)
Location 4:181964228-181964250
Sequence AGGCTGTGTCTAGGTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984622004_984622016 24 Left 984622004 4:181964228-181964250 CCAATTGCACCTAGACACAGCCT No data
Right 984622016 4:181964275-181964297 CAAAGTAAGATATGGACTTAGGG No data
984622004_984622010 16 Left 984622004 4:181964228-181964250 CCAATTGCACCTAGACACAGCCT No data
Right 984622010 4:181964267-181964289 TCCCCCAACAAAGTAAGATATGG No data
984622004_984622015 23 Left 984622004 4:181964228-181964250 CCAATTGCACCTAGACACAGCCT No data
Right 984622015 4:181964274-181964296 ACAAAGTAAGATATGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984622004 Original CRISPR AGGCTGTGTCTAGGTGCAAT TGG (reversed) Intergenic
No off target data available for this crispr