ID: 984622008

View in Genome Browser
Species Human (GRCh38)
Location 4:181964248-181964270
Sequence GGGATTGGCCATTTCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984622008_984622019 22 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622019 4:181964293-181964315 TAGGGTGTCAAAAAGATGAGGGG No data
984622008_984622016 4 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622016 4:181964275-181964297 CAAAGTAAGATATGGACTTAGGG No data
984622008_984622015 3 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622015 4:181964274-181964296 ACAAAGTAAGATATGGACTTAGG No data
984622008_984622010 -4 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622010 4:181964267-181964289 TCCCCCAACAAAGTAAGATATGG No data
984622008_984622018 21 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622018 4:181964292-181964314 TTAGGGTGTCAAAAAGATGAGGG No data
984622008_984622017 20 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622017 4:181964291-181964313 CTTAGGGTGTCAAAAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984622008 Original CRISPR GGGATTGGCCATTTCCTGAG AGG (reversed) Intergenic
No off target data available for this crispr