ID: 984622010

View in Genome Browser
Species Human (GRCh38)
Location 4:181964267-181964289
Sequence TCCCCCAACAAAGTAAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984622008_984622010 -4 Left 984622008 4:181964248-181964270 CCTCTCAGGAAATGGCCAATCCC No data
Right 984622010 4:181964267-181964289 TCCCCCAACAAAGTAAGATATGG No data
984622004_984622010 16 Left 984622004 4:181964228-181964250 CCAATTGCACCTAGACACAGCCT No data
Right 984622010 4:181964267-181964289 TCCCCCAACAAAGTAAGATATGG No data
984622006_984622010 7 Left 984622006 4:181964237-181964259 CCTAGACACAGCCTCTCAGGAAA No data
Right 984622010 4:181964267-181964289 TCCCCCAACAAAGTAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984622010 Original CRISPR TCCCCCAACAAAGTAAGATA TGG Intergenic
No off target data available for this crispr