ID: 984624873

View in Genome Browser
Species Human (GRCh38)
Location 4:181995968-181995990
Sequence CTGGGGCTCTTGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984624873_984624877 -10 Left 984624873 4:181995968-181995990 CCTTCCTCCCTCAAGAGCCCCAG No data
Right 984624877 4:181995981-181996003 AGAGCCCCAGACTCTAAAATAGG No data
984624873_984624881 7 Left 984624873 4:181995968-181995990 CCTTCCTCCCTCAAGAGCCCCAG No data
Right 984624881 4:181995998-181996020 AATAGGCTCCCCTCCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984624873 Original CRISPR CTGGGGCTCTTGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr