ID: 984624883

View in Genome Browser
Species Human (GRCh38)
Location 4:181996007-181996029
Sequence TTGAGTTTGCCTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984624883_984624893 30 Left 984624883 4:181996007-181996029 CCCTCCTCCTCAGGCAAACTCAA No data
Right 984624893 4:181996060-181996082 TTAAGAGGAAAGCATTGGAATGG No data
984624883_984624888 0 Left 984624883 4:181996007-181996029 CCCTCCTCCTCAGGCAAACTCAA No data
Right 984624888 4:181996030-181996052 TAACCCAGAGAAGATGATGGTGG No data
984624883_984624887 -3 Left 984624883 4:181996007-181996029 CCCTCCTCCTCAGGCAAACTCAA No data
Right 984624887 4:181996027-181996049 CAATAACCCAGAGAAGATGATGG No data
984624883_984624892 25 Left 984624883 4:181996007-181996029 CCCTCCTCCTCAGGCAAACTCAA No data
Right 984624892 4:181996055-181996077 GAGTGTTAAGAGGAAAGCATTGG No data
984624883_984624891 15 Left 984624883 4:181996007-181996029 CCCTCCTCCTCAGGCAAACTCAA No data
Right 984624891 4:181996045-181996067 GATGGTGGATGAGTGTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984624883 Original CRISPR TTGAGTTTGCCTGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr