ID: 984632567

View in Genome Browser
Species Human (GRCh38)
Location 4:182076187-182076209
Sequence AAGAAGAAGGAGAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984632567_984632570 28 Left 984632567 4:182076187-182076209 CCAGCCTCTTTCTCCTTCTTCTT No data
Right 984632570 4:182076238-182076260 CAGAGTCTTGCTCTGTTGCCAGG 0: 574
1: 2358
2: 6510
3: 11119
4: 14914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984632567 Original CRISPR AAGAAGAAGGAGAAAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr