ID: 984633003

View in Genome Browser
Species Human (GRCh38)
Location 4:182080149-182080171
Sequence TTGAAACGTGGGTTAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984633003_984633009 19 Left 984633003 4:182080149-182080171 CCTCTGCCTAACCCACGTTTCAA No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data
984633003_984633008 1 Left 984633003 4:182080149-182080171 CCTCTGCCTAACCCACGTTTCAA No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data
984633003_984633007 -5 Left 984633003 4:182080149-182080171 CCTCTGCCTAACCCACGTTTCAA No data
Right 984633007 4:182080167-182080189 TTCAAAACTCTTTGCAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984633003 Original CRISPR TTGAAACGTGGGTTAGGCAG AGG (reversed) Intergenic
No off target data available for this crispr