ID: 984633004

View in Genome Browser
Species Human (GRCh38)
Location 4:182080155-182080177
Sequence AGAGTTTTGAAACGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984633004_984633008 -5 Left 984633004 4:182080155-182080177 CCTAACCCACGTTTCAAAACTCT No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data
984633004_984633009 13 Left 984633004 4:182080155-182080177 CCTAACCCACGTTTCAAAACTCT No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984633004 Original CRISPR AGAGTTTTGAAACGTGGGTT AGG (reversed) Intergenic
No off target data available for this crispr