ID: 984633005

View in Genome Browser
Species Human (GRCh38)
Location 4:182080160-182080182
Sequence TGCAAAGAGTTTTGAAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984633005_984633013 30 Left 984633005 4:182080160-182080182 CCCACGTTTCAAAACTCTTTGCA No data
Right 984633013 4:182080213-182080235 GCCAGATGTGAAATTCAGGTTGG No data
984633005_984633012 26 Left 984633005 4:182080160-182080182 CCCACGTTTCAAAACTCTTTGCA No data
Right 984633012 4:182080209-182080231 TGAGGCCAGATGTGAAATTCAGG No data
984633005_984633009 8 Left 984633005 4:182080160-182080182 CCCACGTTTCAAAACTCTTTGCA No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data
984633005_984633008 -10 Left 984633005 4:182080160-182080182 CCCACGTTTCAAAACTCTTTGCA No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984633005 Original CRISPR TGCAAAGAGTTTTGAAACGT GGG (reversed) Intergenic
No off target data available for this crispr