ID: 984633007

View in Genome Browser
Species Human (GRCh38)
Location 4:182080167-182080189
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984633003_984633007 -5 Left 984633003 4:182080149-182080171 CCTCTGCCTAACCCACGTTTCAA No data
Right 984633007 4:182080167-182080189 TTCAAAACTCTTTGCAAGTAAGG No data
984633002_984633007 4 Left 984633002 4:182080140-182080162 CCTCGATCACCTCTGCCTAACCC No data
Right 984633007 4:182080167-182080189 TTCAAAACTCTTTGCAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr