ID: 984633008

View in Genome Browser
Species Human (GRCh38)
Location 4:182080173-182080195
Sequence ACTCTTTGCAAGTAAGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984633002_984633008 10 Left 984633002 4:182080140-182080162 CCTCGATCACCTCTGCCTAACCC No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data
984633005_984633008 -10 Left 984633005 4:182080160-182080182 CCCACGTTTCAAAACTCTTTGCA No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data
984633003_984633008 1 Left 984633003 4:182080149-182080171 CCTCTGCCTAACCCACGTTTCAA No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data
984633004_984633008 -5 Left 984633004 4:182080155-182080177 CCTAACCCACGTTTCAAAACTCT No data
Right 984633008 4:182080173-182080195 ACTCTTTGCAAGTAAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984633008 Original CRISPR ACTCTTTGCAAGTAAGGATG TGG Intergenic
No off target data available for this crispr