ID: 984633009

View in Genome Browser
Species Human (GRCh38)
Location 4:182080191-182080213
Sequence TGTGGAAATAGTTCCACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984633005_984633009 8 Left 984633005 4:182080160-182080182 CCCACGTTTCAAAACTCTTTGCA No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data
984633002_984633009 28 Left 984633002 4:182080140-182080162 CCTCGATCACCTCTGCCTAACCC No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data
984633006_984633009 7 Left 984633006 4:182080161-182080183 CCACGTTTCAAAACTCTTTGCAA No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data
984633004_984633009 13 Left 984633004 4:182080155-182080177 CCTAACCCACGTTTCAAAACTCT No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data
984633003_984633009 19 Left 984633003 4:182080149-182080171 CCTCTGCCTAACCCACGTTTCAA No data
Right 984633009 4:182080191-182080213 TGTGGAAATAGTTCCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984633009 Original CRISPR TGTGGAAATAGTTCCACCTG AGG Intergenic
No off target data available for this crispr