ID: 984640318

View in Genome Browser
Species Human (GRCh38)
Location 4:182157759-182157781
Sequence TGGAACGCCCTTACCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984640318_984640325 15 Left 984640318 4:182157759-182157781 CCAGGAGAGGTAAGGGCGTTCCA 0: 1
1: 0
2: 1
3: 3
4: 77
Right 984640325 4:182157797-182157819 ATGGACAACTGAGGCATCAACGG No data
984640318_984640324 6 Left 984640318 4:182157759-182157781 CCAGGAGAGGTAAGGGCGTTCCA 0: 1
1: 0
2: 1
3: 3
4: 77
Right 984640324 4:182157788-182157810 GGAAACACAATGGACAACTGAGG 0: 1
1: 0
2: 3
3: 11
4: 201
984640318_984640322 -4 Left 984640318 4:182157759-182157781 CCAGGAGAGGTAAGGGCGTTCCA 0: 1
1: 0
2: 1
3: 3
4: 77
Right 984640322 4:182157778-182157800 TCCAGGAGAGGGAAACACAATGG 0: 1
1: 0
2: 4
3: 33
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984640318 Original CRISPR TGGAACGCCCTTACCTCTCC TGG (reversed) Intronic
904521776 1:31101339-31101361 TTGCACACCCTGACCTCTCCTGG - Intergenic
904682585 1:32239855-32239877 GGGAGGCCCCTTACCTCTCCAGG + Intergenic
905404065 1:37721566-37721588 TGGAGTGCCCCTGCCTCTCCAGG - Intronic
905630500 1:39515511-39515533 TTGAACTCCCTCACCTCTCGGGG - Intronic
905667261 1:39770678-39770700 TTGAACTCCCTCACCTCTCGGGG + Exonic
905790420 1:40786377-40786399 AGGACCGCCCCTTCCTCTCCAGG + Intronic
906612744 1:47214494-47214516 TGGAATGCCTTGCCCTCTCCTGG + Intergenic
911533617 1:99075288-99075310 TGAAACCCCCTCACTTCTCCAGG - Intergenic
914680347 1:149934526-149934548 TGGAATGTCCTTTCCTCTGCAGG - Exonic
915070528 1:153261815-153261837 CGGGACGCCCTTGCCACTCCCGG - Exonic
918247755 1:182674946-182674968 TGGGAAGCCCTGCCCTCTCCAGG + Intronic
921708171 1:218347121-218347143 GGGATCGCCCTTCCCTCTCGCGG + Intronic
1063604275 10:7508593-7508615 TGCAGCGCCCTTAGCCCTCCAGG + Intergenic
1066978574 10:42390988-42391010 GGAAACTCCCTCACCTCTCCAGG - Intergenic
1078811077 11:14764076-14764098 TGGAAAGCTGTTACCTCACCTGG + Intronic
1083334664 11:61915619-61915641 AGGACTGCCCTAACCTCTCCAGG + Intronic
1083933125 11:65856958-65856980 TGGATTGCCCCTCCCTCTCCTGG - Intronic
1084330064 11:68424995-68425017 TGGAAAGCCCCTGCCTCTCAGGG - Intronic
1087603907 11:100351104-100351126 TGAAATGTCCTTGCCTCTCCTGG + Intronic
1091545877 12:1500989-1501011 GGCAACGCCCTCACGTCTCCAGG - Intergenic
1092923714 12:13255849-13255871 TGGCACCCCCTTGCCTCGCCGGG + Intergenic
1095716008 12:45346762-45346784 TGGAAGGCCCTTGGCTGTCCTGG - Intronic
1096525832 12:52209724-52209746 AGGAAGGCCCTTCCCTCTCTGGG - Intergenic
1100705698 12:97197905-97197927 AGTCACGCCCTTACCTCTTCTGG - Intergenic
1114515010 14:23293517-23293539 GAGAACCCACTTACCTCTCCTGG + Intronic
1123771847 15:23537013-23537035 TGGACAGCCCTAACCTCTCTGGG + Intergenic
1125744132 15:41987611-41987633 TGAAACTCCCTGTCCTCTCCAGG - Intronic
1129660867 15:77552202-77552224 TGGACAGCTCTTACCTGTCCAGG + Intergenic
1129660875 15:77552238-77552260 TGGACAGCTCTTACCTGTCCGGG + Intergenic
1129858700 15:78843563-78843585 AGGAAAGCCCTTTCCTCTCTGGG + Intronic
1132774038 16:1581970-1581992 TTGAACGCCCCCACCTCTTCAGG - Intronic
1135649365 16:24192572-24192594 TGGACCTCCCTTTCCTCTCTTGG + Intronic
1141883848 16:86878596-86878618 TGGTAGGCCCTGACCTTTCCTGG + Intergenic
1143768662 17:9153835-9153857 TGGGACATCCTTACCTCGCCTGG + Intronic
1144533992 17:16069257-16069279 TGGAGTGCCCTTCCCTCTGCAGG + Intronic
1145863586 17:28226732-28226754 TGGGACTCCCTTTCCTTTCCAGG + Intergenic
1146895138 17:36535296-36535318 TGGCGCGCCGTTTCCTCTCCAGG + Intronic
1148957970 17:51369784-51369806 TGGGACGTTCTTACCTGTCCAGG + Intergenic
1159036877 18:63285992-63286014 TTCAATGCCCTTACTTCTCCTGG + Intronic
1160784252 19:892400-892422 TCCAACGCCCTTAGCTCTCCAGG + Intronic
1163439752 19:17316132-17316154 TGGAACGCTCTTCCCTCTCCTGG - Intronic
1164941980 19:32257704-32257726 TTGAACGCCTTCACCTGTCCAGG - Intergenic
933026268 2:77263207-77263229 TGGAATTCCCTGCCCTCTCCAGG - Intronic
934504595 2:94880465-94880487 TGGAAAGCCCTTCCCTCCCTGGG - Intergenic
946388918 2:219404015-219404037 TGGAACACCCTCACCTCCACAGG - Intergenic
948807975 2:240461118-240461140 TGGAACGCCCTGGCCTGTCCCGG - Intronic
1179572599 21:42286783-42286805 GGGAATGCCCTCATCTCTCCAGG - Intronic
1179774084 21:43648457-43648479 TGGAGCGCCATTGCCTCCCCTGG - Intronic
1179989667 21:44940491-44940513 GGGAACGTCCTTTCCTTTCCGGG - Intronic
1181530311 22:23513585-23513607 AGGAATGCCCTTTCCCCTCCAGG - Intergenic
1182747506 22:32616888-32616910 TGGAACGTCCTTTCCTCTGTTGG - Intronic
953352906 3:42229576-42229598 TGGAACATCCTTACTTCCCCAGG - Intergenic
957707818 3:83813137-83813159 GGGAACGCTCCTACCTCTGCAGG - Intergenic
967821286 3:193841700-193841722 TTGAAAGCCCTTCCCTCTCTGGG - Intergenic
968038142 3:195565940-195565962 TGGGACCCCCCTACCTCCCCCGG + Intergenic
969220233 4:5754340-5754362 GGGAACTCCCTTCCTTCTCCTGG - Intronic
969661530 4:8532475-8532497 TGGAATGCCCTGTCCTCTCTTGG + Intergenic
976454817 4:85234062-85234084 TGGATCCCCCTCACCTCTGCAGG - Intergenic
977897465 4:102380699-102380721 GGGCACGCCATTGCCTCTCCTGG - Intronic
978435252 4:108677022-108677044 GGGAACTTCCTTACCTCTCAAGG + Intergenic
979966057 4:127077579-127077601 GGGAACTCCCTCCCCTCTCCAGG - Intergenic
980394816 4:132197898-132197920 TGAATTCCCCTTACCTCTCCAGG + Intergenic
984640318 4:182157759-182157781 TGGAACGCCCTTACCTCTCCTGG - Intronic
984872799 4:184342118-184342140 TGGAACTCACATACCTCTTCTGG + Intergenic
985936830 5:3103695-3103717 TAGAAAGCCCTGACCTTTCCCGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
988985032 5:36609768-36609790 TGGAAAGCCATTACTTCTCTGGG - Intronic
1006521527 6:34573789-34573811 TGGTACCCCCTTCCCTGTCCTGG - Intergenic
1010103194 6:72134933-72134955 TGGAAAGCCTTTATCTCTCCAGG - Intronic
1013070944 6:106728591-106728613 AGAGAGGCCCTTACCTCTCCAGG - Intergenic
1017707910 6:157140809-157140831 TGGAAGGCCGCTGCCTCTCCCGG - Intronic
1018646319 6:165951985-165952007 TGGAAAGTACTTACCTCCCCTGG - Intronic
1022011078 7:26308584-26308606 TGGAGCTCCCATACCTCCCCAGG - Intronic
1029203584 7:98855226-98855248 TGGAGCTCACTTACCTCCCCAGG + Exonic
1032096485 7:128940761-128940783 AGGGCCGGCCTTACCTCTCCTGG + Intronic
1039254158 8:35700617-35700639 TGGGAAGCCCTTCCCTCTTCAGG - Intronic
1056132501 9:83600178-83600200 TGGAAATCTCTTACCTCTCTCGG - Intergenic
1058528452 9:105883312-105883334 TGAACCCTCCTTACCTCTCCAGG + Intergenic
1059948816 9:119440602-119440624 TGGTACACCCTTTCTTCTCCAGG + Intergenic
1061250041 9:129421217-129421239 AGGAATGCCCTTTCCCCTCCAGG + Intergenic
1062016422 9:134293484-134293506 AGGAACGCCCTTATCCTTCCAGG - Intergenic
1062681640 9:137785180-137785202 TGGGAGGCCCTCTCCTCTCCTGG + Intronic