ID: 984642053

View in Genome Browser
Species Human (GRCh38)
Location 4:182177433-182177455
Sequence GGCTGAAGACCAAGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 530}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984642053_984642060 7 Left 984642053 4:182177433-182177455 CCCGCTGCCCTTGGTCTTCAGCC 0: 1
1: 0
2: 6
3: 51
4: 530
Right 984642060 4:182177463-182177485 TGCTCCTGATTCACTGTTTTGGG 0: 1
1: 0
2: 1
3: 19
4: 169
984642053_984642059 6 Left 984642053 4:182177433-182177455 CCCGCTGCCCTTGGTCTTCAGCC 0: 1
1: 0
2: 6
3: 51
4: 530
Right 984642059 4:182177462-182177484 ATGCTCCTGATTCACTGTTTTGG 0: 1
1: 0
2: 0
3: 13
4: 175
984642053_984642063 22 Left 984642053 4:182177433-182177455 CCCGCTGCCCTTGGTCTTCAGCC 0: 1
1: 0
2: 6
3: 51
4: 530
Right 984642063 4:182177478-182177500 GTTTTGGGGCATTTCTGCTATGG 0: 1
1: 0
2: 0
3: 11
4: 136
984642053_984642061 8 Left 984642053 4:182177433-182177455 CCCGCTGCCCTTGGTCTTCAGCC 0: 1
1: 0
2: 6
3: 51
4: 530
Right 984642061 4:182177464-182177486 GCTCCTGATTCACTGTTTTGGGG 0: 1
1: 0
2: 4
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984642053 Original CRISPR GGCTGAAGACCAAGGGCAGC GGG (reversed) Intronic
900516573 1:3085035-3085057 GGCTGGGGACCAAGGGGTGCAGG - Intronic
900588954 1:3450860-3450882 GGCTGAAAACCAGGGACAGAGGG - Intergenic
900752942 1:4410668-4410690 GGCAGAAGGCGAAGGGAAGCAGG - Intergenic
900991647 1:6100844-6100866 GGCAGAAGACCAAGGGCAGTCGG + Exonic
901771954 1:11535096-11535118 TGCTGAGGAGCACGGGCAGCAGG - Exonic
902088569 1:13883744-13883766 AGCTGAAGACCCAGGAAAGCTGG + Intergenic
902149517 1:14431715-14431737 GTCTAATGTCCAAGGGCAGCAGG - Intergenic
902392939 1:16116623-16116645 GGCTGAAGGCAGAGGGCAGGGGG - Intergenic
903142079 1:21345014-21345036 GCTTGGAGACCCAGGGCAGCCGG - Intronic
903784426 1:25848699-25848721 GGCTGAAAACTAAAGTCAGCAGG + Intronic
904982188 1:34515146-34515168 GGTAGAAGGCCAAGGGGAGCAGG + Intergenic
905116013 1:35641436-35641458 GGCGGAAGGCCAGGGGCTGCAGG + Exonic
905381200 1:37562659-37562681 GGAAGAAGTCAAAGGGCAGCAGG + Intronic
905675828 1:39824405-39824427 GCCTGAAGAGCAATGACAGCTGG + Intergenic
905825555 1:41023672-41023694 GGCTTGAGACCAAGGGAGGCTGG - Intergenic
907083611 1:51648295-51648317 AGCTGAAGATCACTGGCAGCTGG + Intronic
907293357 1:53432991-53433013 TGCTGAAGACCCAGGACAGGAGG + Intergenic
907310663 1:53537205-53537227 GGCTGAAGCCCAAGATCCGCTGG + Intronic
907492089 1:54814793-54814815 GGCTCAAGACCCAGGGCTGCTGG + Intronic
909020466 1:70425663-70425685 GGCAGAAGGCAAAGGGGAGCAGG + Intronic
909524096 1:76603088-76603110 TACTGAAGACGAAGAGCAGCAGG + Intronic
909564375 1:77038699-77038721 GCCTGAAGAGCAAGAGCAGAAGG - Intronic
910429210 1:87144591-87144613 GTCTGATGTCCAAGGGCAGGAGG - Intronic
910520552 1:88117194-88117216 GGCTGAAGAACTAGGGAAGGAGG - Intergenic
911064959 1:93779932-93779954 GGGTGGAGGCCAAGGGCAACAGG - Intronic
911625535 1:100119753-100119775 GGCTGAAGGCAAAGGGGAGCAGG - Intronic
912106191 1:106278691-106278713 GTCTGAAGTCCGAGGGCAGGAGG + Intergenic
912949954 1:114113763-114113785 GGCGGGAGAGCAAGGGAAGCAGG - Intronic
913971868 1:143422582-143422604 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
914066247 1:144248195-144248217 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
914112906 1:144718159-144718181 TGGTGAAGAGCAAGGGCTGCAGG - Intergenic
914342658 1:146773613-146773635 TGCTGAAGGCCATTGGCAGCCGG + Intergenic
914966027 1:152257873-152257895 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
915217523 1:154349956-154349978 GGCTCCAGCCCAAGGCCAGCAGG - Exonic
915744454 1:158145361-158145383 GGCTGAATGCCAAGGCCATCTGG - Intergenic
917587915 1:176446581-176446603 GGCTCAAGACCAAGGGAGGGAGG - Intergenic
917942193 1:179933466-179933488 GTCTGATGTCCAAGGGCAGGGGG + Intergenic
920294712 1:204948862-204948884 GGCTAAGGGCCAAGGGGAGCGGG + Intronic
920301826 1:204993661-204993683 GCCTGGCGACCAAGGACAGCGGG - Intronic
922156904 1:223047677-223047699 GGCTGATGTTCAAGGGCAGGAGG + Intergenic
922891969 1:229068506-229068528 GCCTGCAGTCCAAGAGCAGCCGG + Intergenic
923188703 1:231598908-231598930 GGCAGAAGGCGAAGGGGAGCAGG + Intronic
923213004 1:231822799-231822821 GGCAGAAGATGAAGGGGAGCTGG + Intronic
923492891 1:234499809-234499831 GGCTGAAGGCCAAGGGACTCGGG + Intergenic
1063411820 10:5842140-5842162 GGCGGAAGGCGAAGGGGAGCAGG + Intergenic
1063479993 10:6367108-6367130 GGCAGAAGGCAAAGGGAAGCAGG + Intergenic
1063787174 10:9398722-9398744 GGCTAAAGAACACTGGCAGCTGG - Intergenic
1064184278 10:13147222-13147244 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
1065809528 10:29428500-29428522 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1065864583 10:29903000-29903022 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1066005593 10:31143714-31143736 GGCAGAAGAGAAAGGGGAGCTGG - Intergenic
1066437600 10:35408266-35408288 TGCCGAAGACCCAGGTCAGCGGG - Intronic
1067227338 10:44384698-44384720 GGCTGCAGAGCGAGGTCAGCCGG - Intronic
1068199179 10:53761007-53761029 GGCTGAAGGCAAAGAGAAGCTGG + Intergenic
1068650438 10:59516792-59516814 GGCTGAAGACCAAGGGTGGTGGG - Intergenic
1069691374 10:70355270-70355292 GGCTTAAGACAAAAAGCAGCCGG + Intronic
1069817293 10:71206504-71206526 GTCTGATGTCCGAGGGCAGCAGG - Intergenic
1070290456 10:75110456-75110478 GTCTTAAGGCCAAGGGCAGCTGG - Intronic
1071186832 10:83056144-83056166 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1071673607 10:87634822-87634844 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1072538535 10:96381201-96381223 GGCTGGAGGACCAGGGCAGCAGG - Intronic
1073013630 10:100381311-100381333 TGCTGAAGACCCAGGACAGGAGG + Intergenic
1073288929 10:102403862-102403884 GGCTGAAGAGCAGCGGCAGAAGG - Exonic
1073589452 10:104742608-104742630 GGCTGCAGACCTTGGACAGCTGG + Intronic
1074084614 10:110199339-110199361 GGCTGATGAGCTAGTGCAGCTGG - Intergenic
1074464397 10:113668590-113668612 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1075741955 10:124701455-124701477 GGCTGAAGACCAAAGGGAGCTGG - Intronic
1075935483 10:126337430-126337452 GTCTGATGTCCAAGGGCAGGAGG + Intronic
1076140387 10:128073678-128073700 GGCTAAGGATAAAGGGCAGCGGG - Intronic
1076741803 10:132489296-132489318 GGCTGGAGGCCAAGAACAGCAGG - Intergenic
1076940401 10:133602879-133602901 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1077260208 11:1613772-1613794 AGCTGAAGACCTAGGAAAGCCGG - Intergenic
1077307995 11:1876454-1876476 TGGTGAAGAGCAAGGGCTGCGGG - Intronic
1078065984 11:8080071-8080093 GGCTGTAGCCCCAGGGCAGCAGG + Intronic
1078178596 11:8990184-8990206 GGCTGTAGAGTAAAGGCAGCAGG - Intronic
1078582031 11:12546231-12546253 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1079744539 11:24107846-24107868 GGCTGAAGGCAAGGGGAAGCAGG - Intergenic
1080588832 11:33703961-33703983 GTCTGAGGACCAAGGGAACCCGG - Intronic
1081627067 11:44662508-44662530 GGCTGCTGACCAGGGGCAGGTGG + Intergenic
1083191124 11:61052998-61053020 GGCTGGAGACCTGGGGCAGCAGG + Intergenic
1084410430 11:69003399-69003421 GGCTGAGGAGCAGGGGCAGGAGG + Intergenic
1084682420 11:70674142-70674164 GGCGGAAGGCTAAGGGGAGCTGG - Intronic
1085232158 11:74981552-74981574 GGGTGTAGGCCATGGGCAGCTGG + Intergenic
1085640192 11:78188572-78188594 GGCTGCAGAGCGAGGGCAGGAGG - Exonic
1085656052 11:78316073-78316095 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1086411857 11:86551788-86551810 GGCTCAGGGCCAAGGGCTGCTGG + Intronic
1086821890 11:91445651-91445673 GGCTGGAGTCCCAGGGCAGTGGG - Intergenic
1087409319 11:97770724-97770746 GGCAGAAGGCTAAGGGGAGCTGG + Intergenic
1087501358 11:98958684-98958706 GGCAGAAGGCCCAGGGCAGCAGG + Intergenic
1088484271 11:110325643-110325665 GGCTGCAGCCCAAGGACAACAGG + Intergenic
1088687653 11:112298363-112298385 GTCTGATGGCCAAGGGCAGGAGG + Intergenic
1088826360 11:113497452-113497474 GACTGGACACCAAGGGCAGCAGG + Intergenic
1089753104 11:120665890-120665912 TCCTGAAGACCAAGGGAAGACGG - Intronic
1089840522 11:121413510-121413532 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1090208393 11:124898231-124898253 AGCTGAAGACAGAGGGCAGTGGG + Exonic
1090348990 11:126094891-126094913 GGCTGAAGGCCAAGAGCCCCTGG - Intergenic
1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG + Intergenic
1090802253 11:130180223-130180245 GGCTGAAGATCAAGGTCAAGGGG - Intronic
1091147365 11:133291432-133291454 GGCTGACCACCAAGGGAAGGGGG - Intronic
1092369039 12:7901305-7901327 AGGTGAAGACCTAGGGCAGAAGG + Intergenic
1092634390 12:10426032-10426054 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1092635435 12:10441457-10441479 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1092993971 12:13930487-13930509 GGCTCAAGATCAGGGGCAGGTGG - Intronic
1093306673 12:17528668-17528690 GGCAAAAGACAAAGGGGAGCTGG - Intergenic
1093498557 12:19784017-19784039 GGCTGGAGACCCAGGCCAGTGGG + Intergenic
1093740419 12:22679305-22679327 TTCTGAAGTCCAAGGGCAGGAGG + Intronic
1094057746 12:26283945-26283967 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1094671571 12:32575337-32575359 GGCAGAAGATAAAGGGTAGCTGG + Intronic
1096906150 12:54937708-54937730 GGCTGATGTCCAAAGGCAGGAGG - Intergenic
1098197490 12:68017304-68017326 GGTTGAATTCCAAGGGCAACTGG + Intergenic
1098515696 12:71374134-71374156 GTCTTAAAACCAAGGGCAGAAGG - Intronic
1098891506 12:76014129-76014151 TGGGGGAGACCAAGGGCAGCCGG - Intergenic
1099099689 12:78423206-78423228 GGCAGAAGGCGAAGGGAAGCAGG - Intergenic
1100067671 12:90669708-90669730 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1100204251 12:92331024-92331046 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1100338060 12:93651449-93651471 GTCTGATGTCCAAGGGCAGTAGG - Intergenic
1100603608 12:96132998-96133020 TGCTGGAGACCAAGGCCACCTGG + Intergenic
1101306012 12:103528629-103528651 GGCAGAAGGCGAAGGGGAGCTGG - Intergenic
1101529257 12:105559408-105559430 GGGTGAAGTCCAAGGGCAAAAGG - Intergenic
1101757116 12:107629682-107629704 GGCTGCAGTCTCAGGGCAGCAGG - Intronic
1102049553 12:109852780-109852802 GGCTGAGGAGCCAGGCCAGCAGG + Intronic
1102491437 12:113291726-113291748 GGCTGAAGAGCAGGGGCAGCTGG - Intronic
1102948474 12:117011192-117011214 GGCTGAGGGCCAGGGGCTGCTGG + Intronic
1103630751 12:122258569-122258591 AGCTGAAGACAAAGGCCAACAGG + Intronic
1103901156 12:124304213-124304235 GGCTGGACACCAAGGGAAGATGG - Intronic
1104034931 12:125091591-125091613 GGCTGAATTCCCAGGGGAGCCGG + Intronic
1104221641 12:126790207-126790229 GGCTGCTGACCACGGGCTGCAGG - Intergenic
1104431274 12:128718344-128718366 GTCTGACGTCCAAGGGCAGGAGG - Intergenic
1104700323 12:130898201-130898223 GGCTGATGTCCAAGGGCAGAAGG + Intergenic
1104879336 12:132059301-132059323 CCCTGAAGGCCAAGGGCAGATGG - Intronic
1105276199 13:18929234-18929256 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1105753571 13:23444373-23444395 GGCTGGAGACCCAGGGAAGCTGG - Intergenic
1106109909 13:26767642-26767664 CCCTGAAGGCCAAGGCCAGCAGG + Intergenic
1106353807 13:28959591-28959613 GGCAGAAGATGAAGGGGAGCTGG + Intronic
1108027712 13:46195865-46195887 GGCGGAAGGCAAAGGGGAGCTGG - Intronic
1108168983 13:47721879-47721901 GTCTGATGTCCAAGGGCAGAAGG - Intergenic
1108732199 13:53246683-53246705 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1110360713 13:74621604-74621626 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1113314052 13:109159854-109159876 GGCTGGGGCCCAAGGCCAGCAGG + Intronic
1114566842 14:23639326-23639348 GGCTGAGGACCGGGAGCAGCTGG + Exonic
1114792437 14:25674694-25674716 GGTTGAAGAGCAGGGGCAACAGG + Intergenic
1117092858 14:52267979-52268001 TGTAGAAGACCGAGGGCAGCGGG - Exonic
1117674532 14:58142401-58142423 GGCTGAAGACAAAAAGAAGCCGG + Intronic
1118090713 14:62473997-62474019 GGCTGAGAACCAAGGGCTGAGGG + Intergenic
1118690490 14:68334444-68334466 GGCTGAAGAACAGGAGGAGCTGG + Intronic
1118792223 14:69105670-69105692 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1118929675 14:70230005-70230027 AGCTGGAGACCTAGGCCAGCAGG - Intergenic
1119248641 14:73133634-73133656 TGCTGAAGACCCAGGACAGGAGG - Intergenic
1119262287 14:73244973-73244995 AGCTGGAGACCAGGGGCAACAGG - Intronic
1120624154 14:86803678-86803700 AGCTGAAGAACGAGGGAAGCTGG - Intergenic
1121283083 14:92713521-92713543 GGCCGAAGACCAGCAGCAGCAGG + Intronic
1121942350 14:98083136-98083158 AGCTGTAGACCAAAGGAAGCTGG - Intergenic
1122181153 14:99955758-99955780 GGCCTAAGAACAAGGGGAGCTGG - Intergenic
1122367675 14:101203834-101203856 AGCTGGAGACCCAGGGTAGCAGG - Intergenic
1122462757 14:101909020-101909042 GGCTGCAGTCCCATGGCAGCTGG + Intronic
1122631214 14:103108616-103108638 GCCTGAAGACCAGAGGCAGGAGG + Intronic
1123161680 14:106284611-106284633 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1123177413 14:106434065-106434087 GGCAGAAGACAAAGAGGAGCAGG - Intergenic
1123213957 14:106788780-106788802 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1202836258 14_GL000009v2_random:79434-79456 GGCTGGAGACCCAGGTCAGTAGG - Intergenic
1123400861 15:19984316-19984338 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1124722182 15:32119990-32120012 TGCTGAAGACCAGGAGCTGCGGG - Intronic
1124855076 15:33379932-33379954 GTCTGATGTCCAAGGGCAGGAGG + Intronic
1125204618 15:37139041-37139063 GGCTGAAGAGAAAGTTCAGCTGG + Intergenic
1125887934 15:43242732-43242754 GGCTGAAGAACTAGGGCAGGTGG + Intronic
1125902953 15:43366236-43366258 GACTGAAGAGCCAGGGCAGAGGG - Exonic
1128053810 15:64684981-64685003 GGCTGAGCACCAAGGCAAGCGGG - Exonic
1128983913 15:72205698-72205720 GGCTGAGGTCAAAGGGCAGCGGG + Intronic
1129640570 15:77372889-77372911 GGCGGAAGGCCAAGGGAAGCAGG - Intronic
1130283402 15:82536514-82536536 GGCTGAAGACCCAGGGAAGCAGG + Intergenic
1131046946 15:89322450-89322472 GGCTGAGGACCATGGAGAGCTGG - Intronic
1132152393 15:99471715-99471737 AGCTGAAGACCCAGGAAAGCTGG - Intergenic
1132653346 16:1031346-1031368 GCATGTAGACCAAGGGAAGCTGG + Intergenic
1132937768 16:2490258-2490280 GGCTGAGGACCAAAGACAGGAGG + Intronic
1133234779 16:4382701-4382723 GGCTCAGGACAAAGGGCAGGTGG + Exonic
1134181915 16:12054649-12054671 AGCTGAAGACCCAGGAAAGCTGG - Intronic
1134297478 16:12959810-12959832 GGCTGAAAGGCGAGGGCAGCAGG - Intronic
1134341438 16:13350360-13350382 GGCTGGAGACCCAGGGAAGCTGG - Intergenic
1136173394 16:28502051-28502073 GGCTGGGGACCCAGGGCCGCTGG - Exonic
1136278374 16:29192568-29192590 GGCTGAAGCCCACTGTCAGCAGG + Intergenic
1136377471 16:29873735-29873757 GGCAGAAGAACAAGGTCAGGGGG + Intronic
1137463870 16:48690446-48690468 GGCTGGAGACCCAGGGAAGCAGG + Intergenic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1137816403 16:51401895-51401917 GTCTAATGACCAAGGGCAGGAGG + Intergenic
1138028476 16:53540495-53540517 GGCAGAAGGCGAAGGGAAGCAGG + Intergenic
1138077943 16:54061253-54061275 GGCTGCAGAACCAGGGCAGTGGG - Intronic
1138997848 16:62475808-62475830 GGCTGGATACCAAGAGCAGGAGG + Intergenic
1139991326 16:70941715-70941737 TGCTGAAGGCCATTGGCAGCCGG - Exonic
1140423268 16:74838785-74838807 GGCTGCTGGCCAAAGGCAGCGGG - Intergenic
1141036680 16:80632783-80632805 GGATGAAGACCATGGGGAGAGGG - Intronic
1141152173 16:81571939-81571961 GGCTGAAGGCTGAGGGCAGCTGG - Intronic
1142082589 16:88157989-88158011 TGCTCAAGACCAAGGCCACCTGG + Intergenic
1142134201 16:88444188-88444210 GGCTGAGACCCAAGGGCACCTGG - Intergenic
1142688508 17:1591450-1591472 GGGTGAAGATCAAGTTCAGCTGG - Exonic
1142696101 17:1634808-1634830 GGCTGAAGAGGAAAGGCAGGAGG - Exonic
1143364903 17:6400732-6400754 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1143794109 17:9322462-9322484 GCCTGAGGACCAAGCCCAGCAGG + Intronic
1143985650 17:10911407-10911429 GGGTGAAGACAAAGGGTACCAGG + Intergenic
1144666971 17:17108612-17108634 GGCTAGAGACAAAGGCCAGCTGG - Intronic
1144787484 17:17840142-17840164 GGCTGGAGACCCAGGGGAGCCGG + Intergenic
1144959712 17:19038354-19038376 GGCTGGGGACCAGGGCCAGCTGG - Intronic
1144975448 17:19136170-19136192 GGCTGGGGACCAGGGCCAGCTGG + Intronic
1146306576 17:31734374-31734396 GGCTGGAGACCCAAGGCAGAAGG - Intergenic
1146950144 17:36900011-36900033 GGCAGAAGACCCAGGGCAGGTGG + Intergenic
1147843112 17:43386625-43386647 GGCTGAAGAGGAAGTTCAGCTGG + Intergenic
1148873643 17:50673621-50673643 CGATGAGGACCAAGGGCACCTGG + Exonic
1148977891 17:51545536-51545558 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1149447498 17:56725003-56725025 GGGTGGAGAGCAAGGGCGGCTGG - Intergenic
1149910352 17:60560718-60560740 TGCTGAAGTCTAAGGGCAGTAGG + Intergenic
1150286960 17:63960143-63960165 GGCTGTGGACCCAGGGCAGCTGG - Intronic
1151174449 17:72275577-72275599 GTCTGAGGTCCAAGGGCAGGAGG + Intergenic
1151455901 17:74225697-74225719 GGCTGCAGAACGAGGGGAGCAGG + Intronic
1152071070 17:78133824-78133846 GGCAGGAGACCAGGGGCTGCTGG - Intronic
1152281387 17:79386705-79386727 GGCTGGACCCCAAGGGCTGCAGG - Intronic
1152398927 17:80052254-80052276 GGCTGAGGAGCAAGGAGAGCCGG + Intronic
1152790560 17:82276562-82276584 GGCAGAAGGTGAAGGGCAGCTGG + Intergenic
1203170750 17_GL000205v2_random:146264-146286 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1153546153 18:6207307-6207329 GGCTGAAGAACCAGGCCAACTGG + Intronic
1153951988 18:10065207-10065229 GGTGGAAGACAAAGGGGAGCTGG - Intergenic
1155116510 18:22773603-22773625 GGCAGAAGACAAAGGGGAGTGGG - Intergenic
1155326233 18:24667595-24667617 GGTGGAAGATGAAGGGCAGCAGG + Intergenic
1155392169 18:25349803-25349825 GGCGGAGGACAAAGGGCGGCTGG - Intronic
1156239872 18:35242863-35242885 GTTTGATGACCCAGGGCAGCAGG + Exonic
1156749985 18:40440504-40440526 GGCTGAGGACCTTGGGCAGGCGG + Intergenic
1157231484 18:45920561-45920583 GGCAGAAGGCCAACGGGAGCTGG + Intronic
1157707456 18:49819328-49819350 GTCTGATGTCCAAGGGCAGGAGG + Intronic
1157845479 18:51000223-51000245 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1157870604 18:51226981-51227003 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1157871447 18:51233457-51233479 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1158111470 18:53944614-53944636 AGCTGAGGACCAAGGGTAGTGGG + Intergenic
1158628884 18:59095115-59095137 GGCAGAAGACGAAGAGCAGAGGG + Intergenic
1158908029 18:62033032-62033054 GGTTGGGGACCAAGGGAAGCTGG + Intergenic
1158950599 18:62491290-62491312 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1160319112 18:77873753-77873775 GCCTGATGTCCAAGGGCAGGAGG - Intergenic
1160383373 18:78477926-78477948 GGAAGAAGTCAAAGGGCAGCAGG - Intergenic
1160433699 18:78830142-78830164 AGCTGAAAGCCAAGGGCAGATGG + Intergenic
1160845215 19:1163323-1163345 GGCCGCAGACCAAGGGCGCCTGG + Intronic
1161231326 19:3176512-3176534 GGCTGAAGACCACAGGCTCCTGG + Intronic
1161709787 19:5841539-5841561 GGCTGGGAGCCAAGGGCAGCTGG + Intergenic
1162577285 19:11506303-11506325 GGCGGAAGACCACGGGGATCTGG + Exonic
1163635334 19:18434706-18434728 GGGTGATGACCATGGGCAGAGGG + Exonic
1164596336 19:29532959-29532981 GGCTGAAGGCCAAGGGAAGAGGG - Intronic
1165389343 19:35529447-35529469 GGCCGAAGACCCAGGGCAGCAGG + Intergenic
1166352171 19:42204473-42204495 GGTGGAAGGCCAAGGGGAGCAGG - Intronic
1168648044 19:58073888-58073910 GGCGGAAGGCAAAGGGGAGCTGG - Intronic
1202636380 1_KI270706v1_random:47931-47953 GGCTGGAGACCCAGGTCAGTAGG + Intergenic
925024700 2:598611-598633 GGCTGAGGAACAAAGGCATCTGG - Intergenic
925440754 2:3883273-3883295 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
925644103 2:6018407-6018429 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
925755260 2:7127539-7127561 GTCTGATGTCCAAGGGCAGGTGG + Intergenic
925778444 2:7357323-7357345 GGCTGGAGTCCATGGGAAGCAGG + Intergenic
926050534 2:9741609-9741631 GGCAGAAGGCAAAGGGAAGCCGG - Intergenic
927151635 2:20199612-20199634 GGCTGAGGCCCAAGGGGAGGTGG + Intergenic
927737086 2:25534138-25534160 GGCCGAAGGCCAAAGGCCGCAGG - Intronic
928275675 2:29898093-29898115 GGGTGAAGAGAAAGGACAGCAGG + Intronic
928696669 2:33856349-33856371 GTCTTAAGACAAATGGCAGCAGG - Intergenic
929684828 2:44024396-44024418 CGCTGAAGACCCAGGTCAGTGGG - Intergenic
929899435 2:45988198-45988220 AGCTGAAGCCATAGGGCAGCAGG - Intronic
930408814 2:50997317-50997339 GGCTGGAGTGCAATGGCAGCTGG - Intronic
930742356 2:54844561-54844583 TGCAGAAGACCAAGGGCACGAGG - Intronic
931133348 2:59365535-59365557 GACTGAAGGCCAAGGGAAGGCGG + Intergenic
932176914 2:69611302-69611324 GTCTGATGCCCAAGGGCAGGAGG - Intronic
932266929 2:70375848-70375870 GGCTGATTACCAAGGGCTGGAGG - Intergenic
933515095 2:83290425-83290447 GGTGAAAGACCAAGGGTAGCAGG + Intergenic
933560780 2:83883446-83883468 AGCTGGAGACCCAGGGAAGCTGG + Intergenic
934025147 2:87996320-87996342 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
934176559 2:89583514-89583536 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
934286869 2:91657875-91657897 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
934506253 2:94897091-94897113 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
934576156 2:95402802-95402824 GGCCGAAGGTCAAGGGCGGCGGG - Exonic
934638333 2:96010656-96010678 GGCGGGAGGTCAAGGGCAGCGGG - Intergenic
934645428 2:96056493-96056515 GGCAGAGAACCAAGGGCTGCGGG - Intergenic
934768806 2:96895089-96895111 GGCTGAAGACACAGGCCAGGCGG - Intronic
934795322 2:97094755-97094777 GGCGGGAGGTCAAGGGCAGCGGG + Exonic
934838832 2:97612582-97612604 GGCAGAGAACCAAGGGCTGCGGG - Intergenic
935654315 2:105408934-105408956 GGCAGCAGAGCAAGGGCAGAGGG + Intronic
935873929 2:107485742-107485764 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
936259752 2:110948618-110948640 GGCTGTAGAGGAAGGGCAGAGGG + Intronic
936525227 2:113236691-113236713 TGCTGTTGAGCAAGGGCAGCGGG + Exonic
937357564 2:121207778-121207800 GGCTGAAGCCAAAGGGATGCTGG + Intergenic
938068140 2:128292782-128292804 GGCAGAGGAACAAGGGCAGCAGG + Intronic
938237323 2:129716963-129716985 GGGTGTAGAGCAAGGGCAGTGGG + Intergenic
939708825 2:145489485-145489507 GGCTGAAGCCCAGAGTCAGCAGG - Intergenic
940711440 2:157167150-157167172 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
941400221 2:165021377-165021399 GTCTGATATCCAAGGGCAGCAGG + Intergenic
942837321 2:180315782-180315804 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
943141390 2:183987039-183987061 AGCTGTAGACCAAGGAAAGCTGG + Intergenic
943155478 2:184169603-184169625 GTCTGATGTCCAAGGGCAGGGGG - Intergenic
943705295 2:191027611-191027633 GGCAGAAGGCAAAGGGAAGCCGG - Intergenic
943769569 2:191701899-191701921 GGCAGAAAACAAAGGGGAGCTGG - Intergenic
944618022 2:201482656-201482678 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
945266690 2:207897898-207897920 GGCTGAAGACAAAGGTCAGGTGG - Intronic
945676931 2:212866520-212866542 GGCGGAAGATGAAGGGGAGCAGG + Intergenic
946359204 2:219209028-219209050 GGCAGAATACCAGCGGCAGCAGG + Exonic
946640406 2:221777769-221777791 GGTGGAAGACCAAGGGTAGCTGG - Intergenic
946643103 2:221805062-221805084 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
946881746 2:224183291-224183313 GGCTGATGACCAAGGAAAACAGG + Intergenic
947255980 2:228164152-228164174 GGCTGATGTCCAAGGGCAGAAGG - Intronic
947676504 2:231986045-231986067 GTCTGATGTCCAAGGGCACCAGG - Intronic
947751308 2:232534143-232534165 GGCTGAAAACCAAGACCAGCGGG - Intronic
947999253 2:234554142-234554164 AGCTGGAGAACAAGGGAAGCTGG - Intergenic
948165874 2:235862126-235862148 GGATGAACACCCAGGACAGCAGG - Intronic
948434202 2:237941962-237941984 GGCTGTTGACCTAGGGAAGCTGG + Intergenic
948607209 2:239143755-239143777 GGCTGTTGACCTAGGGAAGCCGG - Intronic
948696685 2:239736420-239736442 GGCTCAGGCCCAGGGGCAGCCGG - Intergenic
948725135 2:239929846-239929868 GGCTGAGGAGCAGGGGCAGTGGG - Intronic
948733131 2:239979833-239979855 GGCAGCAGGCCAAGGTCAGCCGG - Intronic
1169263142 20:4152114-4152136 GGCTGTATGCCGAGGGCAGCCGG + Intronic
1169885148 20:10390551-10390573 GGCAGAAGGCAAAGGGAAGCTGG + Intergenic
1170089019 20:12569549-12569571 GGCTGATGGCCTAGGGAAGCTGG - Intergenic
1170631892 20:18073114-18073136 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1170804181 20:19615759-19615781 GTCTGATGTCCAAGGGCAGGAGG - Intronic
1170988413 20:21279775-21279797 GGCAGAAGGCAAAGGGGAGCTGG + Intergenic
1171882511 20:30628859-30628881 GGCTGGAGACCCAGGCCAGGAGG + Intergenic
1172484810 20:35291803-35291825 GGCTGAAAAGGAAGCGCAGCAGG + Exonic
1173123924 20:40319242-40319264 GGCTGAAGAACTAGTTCAGCTGG - Intergenic
1173972794 20:47165527-47165549 GCCTGGAGACCAACGGCAGCAGG - Intronic
1174549497 20:51351744-51351766 GTCTGAAGCCCACGGGCAGCAGG + Intergenic
1175665422 20:60854507-60854529 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1175979023 20:62727816-62727838 GGGAGAAGAGCAAGGGCAGGCGG + Intronic
1176326737 21:5508095-5508117 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176330973 21:5548116-5548138 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176396784 21:6272835-6272857 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176401020 21:6312856-6312878 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176420171 21:6507829-6507851 GTCTGATGTCCAAGGGCAGGGGG - Intergenic
1176436137 21:6676248-6676270 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176440373 21:6716269-6716291 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176460399 21:7003318-7003340 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176464635 21:7043338-7043360 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1176483960 21:7385096-7385118 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1176488196 21:7425117-7425139 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1178494602 21:33076123-33076145 GGCTGACAGACAAGGGCAGCAGG + Intergenic
1178908253 21:36653842-36653864 GGCAGAACATCAAGGGCAGAAGG - Intergenic
1179389082 21:40970889-40970911 GGCAGAAGGCAAAGGGCAGCTGG - Intergenic
1179451140 21:41469171-41469193 GGCTGAAGCCCCAGGGTGGCGGG - Intronic
1179586333 21:42376125-42376147 CTCTGAAGCTCAAGGGCAGCTGG + Intronic
1179695663 21:43116149-43116171 GTCTGATGTCCAAGGGCAGGGGG - Intergenic
1180226134 21:46393573-46393595 GGCTGAAGTCCAAGGGCTCGAGG - Intronic
1180364486 22:11926385-11926407 GGCTGGAGACCCAGGTCAGTAGG - Intergenic
1180793982 22:18592907-18592929 GGCTGTAGGCACAGGGCAGCTGG + Intergenic
1180834452 22:18922861-18922883 GGCTGTGGAGCAAGGGCAGGCGG - Exonic
1181039499 22:20185080-20185102 GGCTGAAGGCCAAGGGGAAGAGG + Intergenic
1181227758 22:21402413-21402435 GGCTGTAGGCACAGGGCAGCTGG - Intergenic
1181250894 22:21532426-21532448 GGCTGTAGGCACAGGGCAGCTGG + Intergenic
1181630191 22:24147093-24147115 GACTGAATACCCAGGGCAGCTGG - Intronic
1182206234 22:28630138-28630160 GGCAGAAGGCAAAGGGGAGCTGG - Intronic
1183175373 22:36220656-36220678 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1184515038 22:44956667-44956689 GTCTGAAGCCCAAGGCCAGTGGG + Intronic
1185340311 22:50288028-50288050 GCCGGAACACCTAGGGCAGCGGG + Exonic
1203284541 22_KI270734v1_random:148160-148182 GGCTGTGGAGCAAGGGCAGGCGG - Intergenic
949902246 3:8825606-8825628 AGCTGAAGACCCAGGAAAGCTGG - Intronic
950891453 3:16408274-16408296 GGCTGAGGAGCAAGGGGATCCGG - Intronic
951894616 3:27599439-27599461 TGCTGAAGACCCAGGTCAGAGGG + Intergenic
951999596 3:28770834-28770856 GACTGATGTCCAAGGGCAGGAGG - Intergenic
952296579 3:32067934-32067956 TGCTGAAGACCAGGGTCAGAGGG + Intronic
953545684 3:43862286-43862308 GGCTTAATACAAAGGGCTGCAGG + Intergenic
953545865 3:43863271-43863293 GGCTTAAGACAAAGGGCTGCAGG + Intergenic
954231046 3:49217950-49217972 TGCTGAAGTCCAAGGGGAGTGGG + Intronic
955229948 3:57089820-57089842 AGCTGAAGGTCTAGGGCAGCAGG + Intergenic
955511128 3:59681304-59681326 GGCTGAAGTCAAAGGGAAGCTGG - Intergenic
956777882 3:72580693-72580715 GGCTGATCTCCATGGGCAGCTGG - Intergenic
957008262 3:74975453-74975475 GGCTGAAGGCAAAGAGGAGCTGG + Intergenic
958006529 3:87818961-87818983 AGCTGAAGACAGAGGGGAGCAGG - Intergenic
958518117 3:95147999-95148021 AGCTGGAGACCCAGGGCTGCTGG + Intergenic
958838167 3:99171302-99171324 GGCTGGAGACCTAGGCCAGTGGG - Intergenic
958981558 3:100726202-100726224 GTCTGATGTCCAAGGGCAGGAGG + Intronic
959851150 3:111088285-111088307 GGCAGAAGGCAAAGGACAGCTGG - Intronic
960158031 3:114317851-114317873 GGCAGTAGTCCAAGGGAAGCTGG + Intergenic
960365921 3:116772241-116772263 GACTGGAGCTCAAGGGCAGCAGG - Intronic
961263193 3:125619021-125619043 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
961367372 3:126408631-126408653 GCCTCATGACCAAGGGGAGCCGG - Intronic
962188115 3:133281593-133281615 GGCAGAAGTACAACGGCAGCTGG + Intronic
962278494 3:134033017-134033039 AGCTCAAGACCAAGCGCAGTGGG + Intronic
962357845 3:134710100-134710122 GGCTGAGGTCCCAGGCCAGCTGG - Intronic
962441060 3:135416517-135416539 TGCTGAAGATCAGAGGCAGCAGG - Intergenic
963844384 3:150140642-150140664 TGCTGAAGTCCAAGGGGAGTGGG + Intergenic
964862210 3:161215390-161215412 GTCTGATGTCCAAGGGCAGGAGG - Intronic
965086112 3:164100058-164100080 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
966116399 3:176468400-176468422 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
967213350 3:187188432-187188454 AGCTGAAGACCTAGGAAAGCTGG - Intergenic
967981794 3:195070166-195070188 CTGTGAAGACCCAGGGCAGCAGG - Intronic
968286166 3:197510101-197510123 GGCAGAAGAGCCCGGGCAGCCGG - Exonic
968740789 4:2330814-2330836 TGGTGGAGACCCAGGGCAGCGGG + Intronic
969303324 4:6310082-6310104 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
970647391 4:18138203-18138225 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
971356956 4:25903753-25903775 AGCTGGAGACCCAGGGCAGCTGG + Intronic
972650612 4:41014069-41014091 GGCTGCAGAGCAAGGGCAGCAGG - Exonic
972952572 4:44346279-44346301 GAATGAGGACCAAGGGCATCCGG - Intronic
973366182 4:49211302-49211324 GGCTGGAGACCCAGGCCAGGAGG + Intergenic
973394414 4:49581134-49581156 GGCTGGAGACCCAGGCCAGGAGG - Intergenic
974815574 4:66999729-66999751 GGCAGAAGGCGAAGGGAAGCCGG + Intergenic
975842890 4:78494436-78494458 GGCAGAAGAGGAAGGGGAGCAGG + Intronic
976796222 4:88936374-88936396 GGCAGAAGAAGAAGGGGAGCAGG + Intronic
976946857 4:90780984-90781006 GGCGGAAGGCAAAGGGAAGCAGG + Intronic
977579309 4:98706808-98706830 AGCTGAAGAACAAGGGAAGATGG + Intergenic
977602917 4:98953443-98953465 TTCAGAAGTCCAAGGGCAGCTGG - Intergenic
977604147 4:98965037-98965059 GGCAGAAGGCAAAGGGAAGCTGG - Intergenic
979420609 4:120501387-120501409 GGCGGAAGGCAAAGGGAAGCAGG + Intergenic
979711655 4:123787077-123787099 GGCTGAAGGCTGAGTGCAGCTGG + Intergenic
979960373 4:127012929-127012951 GGCTCCAGGCCAAGGCCAGCTGG + Intergenic
980109723 4:128623528-128623550 GTCTGATGCCCAAGGGCAGGAGG + Intergenic
981612879 4:146614288-146614310 GGCAGAAGGCAAAGGGAAGCTGG - Intergenic
981635150 4:146868995-146869017 GGCAGAAGGCGAAGGGGAGCAGG - Intronic
982101411 4:151971848-151971870 GGTGGAAGACAAAGGGGAGCAGG - Intergenic
982210260 4:153029028-153029050 GAGTGAAGACCTAGGGCATCTGG - Intergenic
983537974 4:168878161-168878183 GGCTGAAGACCGGGGGTGGCGGG - Intronic
983831087 4:172329303-172329325 GGCTGGAGACCTAGGCCAGGAGG + Intronic
984642053 4:182177433-182177455 GGCTGAAGACCAAGGGCAGCGGG - Intronic
984871388 4:184328502-184328524 AGCTGATGAACAAGAGCAGCAGG + Intergenic
1202763698 4_GL000008v2_random:133798-133820 GGCTGGAGACCCAGGTCAGTAGG + Intergenic
985664853 5:1176774-1176796 GGCAGAAGCCGGAGGGCAGCAGG + Intergenic
986138809 5:5009843-5009865 GGCTGTGGACCAAGAGCAGTGGG - Intergenic
986144257 5:5062661-5062683 AGCTGCAGACCTAAGGCAGCTGG + Intergenic
986191740 5:5502794-5502816 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
986677272 5:10197084-10197106 GTCTGATGTCCAAGGGCAGCAGG - Intergenic
987278602 5:16389128-16389150 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
987644086 5:20647466-20647488 GGCTGAAGTCCCAGGACAGTGGG - Intergenic
987963275 5:24838227-24838249 GGCTGGAGACCCAGGAAAGCTGG + Intergenic
988005247 5:25402209-25402231 GTCTGATGCCCAAGGGCAGGAGG - Intergenic
988209358 5:28183439-28183461 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
988671459 5:33386176-33386198 GGCAGAAGGCAAAGGGCAGCAGG + Intergenic
989754849 5:44940020-44940042 GTCTGATGACCAAGGGCAGAAGG - Intergenic
990384390 5:55245478-55245500 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
990442052 5:55856419-55856441 GGCTGATGACCCAGGGATGCAGG + Intronic
991122307 5:63030826-63030848 GGATGCAGAGCAAGAGCAGCTGG + Intergenic
991993931 5:72368725-72368747 GGATGTAGCCCAAGGGCAGCTGG - Intergenic
992791931 5:80221331-80221353 GAATGAAGAGCGAGGGCAGCTGG - Intronic
993318366 5:86440441-86440463 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
993413818 5:87601626-87601648 GGCTGAAGACCCAGGCCTGCAGG + Intergenic
993635047 5:90332810-90332832 AGCTGAAGACCCAGGGAAGCTGG - Intergenic
994501164 5:100580429-100580451 GGCTGAGGAGCAAGGAAAGCAGG + Intronic
994588858 5:101748447-101748469 GTCTGATGTCCAAGGGCAGAAGG - Intergenic
996555964 5:124779108-124779130 GCCTGATGACCAAGGGCAGGAGG - Intergenic
996710477 5:126538237-126538259 GGCGGAAGGCGAAGGGAAGCAGG - Intergenic
996908576 5:128631046-128631068 GTCTGATGTCCAAGGGCAGGAGG + Intronic
996909154 5:128635605-128635627 GTCTGATGCCCAAGGGCAGGAGG + Intronic
998148460 5:139743900-139743922 GGCTGCAGAGCTAGGGCTGCTGG + Intergenic
998296112 5:140970093-140970115 TGGTGAAGACCAAGAGAAGCTGG + Intronic
999399564 5:151253791-151253813 GGCTCATAACCAAGGGCAGCGGG - Intronic
999634173 5:153602894-153602916 GCCTGAAGACAAAGGGCACGAGG - Intronic
1000355306 5:160388804-160388826 GTCTGATGTCCAAGGGCGGCAGG - Intergenic
1000622060 5:163497075-163497097 GGCTGGAGACCCAGGAAAGCAGG + Intergenic
1002337379 5:178489272-178489294 GCCTGATGTCCAAGGGCAGGAGG - Intronic
1002935734 6:1670726-1670748 GGCTGAAGACAAAAGGCACGAGG - Intronic
1003173945 6:3741067-3741089 GGGTGCTGCCCAAGGGCAGCTGG - Intronic
1004584670 6:16987992-16988014 GCTTGAAGACTAAGGACAGCAGG + Intergenic
1005031964 6:21517798-21517820 GGCCGAGGACCAAGGGCATAAGG + Intergenic
1005849068 6:29805390-29805412 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1005860891 6:29899306-29899328 GGCAGAAGACAAAGGTGAGCTGG - Intergenic
1005869147 6:29960604-29960626 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1006976647 6:38108545-38108567 GTCTGATGTCCAAGGGCAGGAGG + Intronic
1007216416 6:40243440-40243462 GGCTGAAGAACCAGGAAAGCTGG - Intergenic
1007498898 6:42280552-42280574 GGCTGAACCCCGAGGGCTGCAGG - Intronic
1007546239 6:42697030-42697052 GGCTGGAGACCGAGGCCAGAAGG - Exonic
1008649045 6:53544874-53544896 GGCAGAAGACCGAGAGCAGGCGG + Exonic
1008909009 6:56713194-56713216 GTCTGAAGACCCTGGGCAGCTGG + Intronic
1009651488 6:66481774-66481796 AGCTGAGGACCGAGGGCAGTGGG - Intergenic
1010831764 6:80540075-80540097 GGCTGATGTTCAAGGGCAGGAGG + Intergenic
1011311454 6:85984057-85984079 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1012002249 6:93667556-93667578 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1012528368 6:100204590-100204612 GGCAGAAGGCCAAGAGGAGCAGG + Intergenic
1013236439 6:108200912-108200934 GGCTGAGGACAAAGTGCACCAGG + Intergenic
1013827469 6:114231333-114231355 GGCAGAAGGCAAAGGGGAGCAGG - Intronic
1017158317 6:151341918-151341940 GGGGCAAGATCAAGGGCAGCGGG - Intronic
1017184014 6:151582705-151582727 GGCAGAAGATGAAGGGGAGCAGG + Intronic
1018269838 6:162065308-162065330 GTCTGATGTCCAAGGGCAGGAGG + Intronic
1018654467 6:166020678-166020700 GTCTGATGTCCAAGGGCAGAAGG - Intergenic
1018766377 6:166936528-166936550 GGCAGAAGGCAAAGGGGAGCTGG + Intronic
1018862315 6:167720104-167720126 GGCTGGAGAGCAGGGACAGCGGG - Intergenic
1019321450 7:417288-417310 GGCTGAAGCCCAGGGGATGCTGG - Intergenic
1019603585 7:1897520-1897542 AGCTGGAGACCCAGGGCAACAGG - Intronic
1019734363 7:2643570-2643592 GGCTGATGCCCAGGGGCAGTGGG - Intronic
1020616101 7:10464564-10464586 GGCGGAAGGCAAAGGGGAGCAGG - Intergenic
1020942492 7:14558926-14558948 TGCTGGAGACCAGGGGCAGCTGG - Intronic
1021081878 7:16374295-16374317 GTCTGATGTCCAAGGGCAGAGGG - Intronic
1021355113 7:19644679-19644701 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1021804142 7:24338531-24338553 GGAAGAAGACCAAGGGGAGGCGG - Intergenic
1022979267 7:35588802-35588824 GCCTGATGTCCAAGGGCAGGAGG - Intergenic
1024042115 7:45563937-45563959 GGCTGGAGACAGAGGGCAACTGG + Intergenic
1024043943 7:45574912-45574934 GGCTGAAGAGCAGCGCCAGCTGG - Exonic
1024429233 7:49266685-49266707 GGCTGAAGGGCAAAGGCAACAGG - Intergenic
1024609010 7:51046808-51046830 GCCTGAAACCCAGGGGCAGCAGG + Intronic
1024813975 7:53245906-53245928 GGCAGAAGGCGAAGGGGAGCTGG - Intergenic
1024858612 7:53811825-53811847 GTCTGACTCCCAAGGGCAGCAGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026165327 7:67904137-67904159 GCCTGATGTCCAAGGGCAGGAGG + Intergenic
1027157980 7:75781942-75781964 TGCTGAAGACCCAGGTCAGTGGG + Intronic
1027269664 7:76512668-76512690 GCCTGAGGACCCAGGGCACCAGG - Intronic
1027320374 7:77006562-77006584 GCCTGAGGACCCAGGGCACCAGG - Intergenic
1028381581 7:90205952-90205974 GGCAGAAGACGAAGGGGAGCAGG - Intronic
1029448396 7:100627326-100627348 GGCCGAAGTCGAGGGGCAGCAGG + Exonic
1029570094 7:101363336-101363358 GGCTGCAGACACCGGGCAGCTGG + Intronic
1030766237 7:113413238-113413260 TGCTGATGTCCAAGGGCAGGAGG + Intergenic
1031172107 7:118304868-118304890 AGCTGAAGACCAAGGGCCAGAGG + Intergenic
1031193472 7:118585104-118585126 GGCAGAAGATGAAGGGGAGCAGG + Intergenic
1032015013 7:128373877-128373899 GGCTGAAGGCCCAGGAAAGCTGG + Intergenic
1032023259 7:128421732-128421754 GGCTGGAGGCCTAGGGCAGGAGG - Intergenic
1032923147 7:136573488-136573510 GGCTGAGGAGCAAGGAGAGCCGG + Intergenic
1033242379 7:139690758-139690780 GGCTGAAGGTGAAGGGGAGCTGG - Intronic
1034933513 7:155182922-155182944 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1035404867 7:158590139-158590161 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1035628217 8:1089494-1089516 TGCTGAAGGCCTGGGGCAGCAGG - Intergenic
1037948353 8:23003486-23003508 GGCTGAAGATCCCAGGCAGCTGG - Intronic
1038856222 8:31335943-31335965 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1039414030 8:37378566-37378588 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1039765364 8:40622699-40622721 GGCGGAAGAGGAAGGGGAGCTGG + Intronic
1039830479 8:41209778-41209800 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1040011215 8:42662605-42662627 GGCTGAAGAGGAAGGGGCGCTGG + Intergenic
1040389640 8:46938840-46938862 GGTTGAAGACCATGGTCACCAGG + Intergenic
1041183332 8:55271643-55271665 GGCTGATGGCCAGGGGCAGCTGG + Intronic
1041255422 8:55976412-55976434 TGCTGGAGACAAAGGTCAGCTGG - Intronic
1041324581 8:56651315-56651337 GGCAGAAAACAAAGGGGAGCTGG + Intergenic
1041456246 8:58063998-58064020 GGCAGAAGGCAAAGGGAAGCAGG + Intronic
1041768434 8:61445492-61445514 GGCTGAAGGTGAAGGGGAGCAGG - Intronic
1043018425 8:74970005-74970027 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1043508972 8:80931310-80931332 GGGAGAGGACCCAGGGCAGCGGG - Intergenic
1044708375 8:95030888-95030910 GGCAGAAGACGAAGGGGAGCAGG + Intronic
1045427411 8:102080822-102080844 GGCTGGAGACCCAGACCAGCTGG - Intronic
1045699466 8:104849841-104849863 GGCTGGAGACCCAGGCCAGGAGG + Intronic
1046121579 8:109854288-109854310 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1046694766 8:117327461-117327483 GCCTGAGAAACAAGGGCAGCAGG - Intergenic
1046984679 8:120374216-120374238 GGCTGAAGACCAAAGCAAGGGGG + Intergenic
1047160218 8:122369816-122369838 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1047537963 8:125736679-125736701 GGCTGGAGACCCAGGAGAGCTGG - Intergenic
1047583963 8:126248827-126248849 GGGTCAAGACCCAGTGCAGCTGG - Intergenic
1048016526 8:130502015-130502037 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1048275535 8:133062992-133063014 GGCTGAGGAACCAAGGCAGCTGG - Intronic
1048279607 8:133095316-133095338 GGCTGATGACCAACTGGAGCTGG + Intronic
1048337867 8:133516282-133516304 GGCAGAAGAAGAAGGGGAGCTGG - Intronic
1048753420 8:137705102-137705124 GGCAGAAGACAAAGGGGACCAGG + Intergenic
1050194775 9:3070221-3070243 GGCAGAAGGCTAAGGGGAGCTGG + Intergenic
1050797325 9:9560676-9560698 TGCTGAAGTCCAAGGGGAGTGGG + Intronic
1050944009 9:11495162-11495184 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1051338861 9:16092857-16092879 GGCTGAAGCCTCAGGCCAGCTGG + Intergenic
1051700408 9:19816672-19816694 GGCAGAAGATGAAGGGGAGCAGG + Intergenic
1051810936 9:21048929-21048951 GGCTGGAGAACCAGGGAAGCCGG + Intergenic
1052003318 9:23315204-23315226 AGCTGAAGAGCAAGGAGAGCTGG - Intergenic
1052010987 9:23409038-23409060 GTCTGATGTCCAAGGGCAGAAGG - Intergenic
1052286041 9:26786787-26786809 GGCTGAAGGGAAAGGGCAGCTGG - Intergenic
1052682067 9:31706234-31706256 GGCTGGAAACCCAGGGAAGCTGG - Intergenic
1053052296 9:34971923-34971945 GGTTGAAAACCCATGGCAGCGGG - Intronic
1053161007 9:35813444-35813466 GGCTGAAGAAGAAGACCAGCAGG - Exonic
1053581205 9:39406292-39406314 GGCAGAAGATGAAGGGGAGCTGG - Intergenic
1053845690 9:42234356-42234378 GGCAGAAGATGAAGGGGAGCTGG - Intergenic
1054102792 9:60965096-60965118 GGCAGAAGATGAAGGGGAGCTGG - Intergenic
1054837438 9:69692687-69692709 GGCAGAAGGCAAAGGGAAGCAGG + Intergenic
1055525636 9:77130399-77130421 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
1055595913 9:77864096-77864118 GGCAGAAGGCAAAGGGAAGCAGG + Intronic
1056165494 9:83937049-83937071 GGCAGAAGAGAAAAGGCAGCTGG + Intergenic
1057446067 9:95115750-95115772 GGCTGTGCACCAAGGGCCGCGGG - Intronic
1057595085 9:96409122-96409144 GGCAGAAGGCGAAGGGGAGCAGG - Intronic
1059282985 9:113150769-113150791 GGGCGAAGACAGAGGGCAGCAGG + Intergenic
1059467012 9:114475429-114475451 GGCTGAAGACAAAGTACAGAGGG - Intronic
1060201600 9:121654707-121654729 GGCTGAAGTTCAAGGTCAGAAGG - Intronic
1061069876 9:128302768-128302790 GGAGGAGGACCAAGAGCAGCAGG + Intergenic
1061362657 9:130153624-130153646 GGCTGAGGACCACGAGGAGCGGG + Intergenic
1061943050 9:133893285-133893307 GGCTGAAGAGGAAGGGAAGAAGG + Intronic
1062228223 9:135465816-135465838 GGGTGACGGCCATGGGCAGCTGG - Intergenic
1062464828 9:136676337-136676359 GGGTGCCCACCAAGGGCAGCTGG + Intronic
1203431127 Un_GL000195v1:92210-92232 GGCTCAGGGCCATGGGCAGCCGG + Intergenic
1203435381 Un_GL000195v1:132413-132435 GGCTCAGGGCCATGGGCAGCCGG - Intergenic
1203544452 Un_KI270743v1:118671-118693 GGCTGGAGACCCAGGTCAGTAGG + Intergenic
1185916458 X:4040989-4041011 GGTGGAAGACGAAGGGGAGCTGG + Intergenic
1186090914 X:6048067-6048089 GGCTTGAGAGCAATGGCAGCTGG - Intronic
1186529651 X:10282359-10282381 GGCAGAAGAGGAAGGGGAGCAGG + Intergenic
1187253085 X:17617026-17617048 GGCTGGAGAGAAAAGGCAGCTGG - Intronic
1188558802 X:31444111-31444133 GGCAGAAGGCAAAGGGGAGCTGG - Intronic
1189216824 X:39332404-39332426 GGCAGAAGGCAAAGGGGAGCTGG + Intergenic
1189785652 X:44556766-44556788 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1189907524 X:45776880-45776902 GGCTGAAGGTCAGGGGCAGGGGG + Intergenic
1190010551 X:46780882-46780904 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1190219237 X:48500348-48500370 GGTAGAAAACCAAGGGCGGCCGG + Intergenic
1191178534 X:57534270-57534292 GTCTGATGTCCAAGGGCAGGAGG - Intergenic
1191649246 X:63519063-63519085 AGATGTAGACCAAGGGAAGCAGG + Intergenic
1192208912 X:69114750-69114772 CTCTGAAGACCAAGAGCTGCAGG + Intergenic
1192923576 X:75733693-75733715 GGCTGGAGACCCAGGCCAGGAGG + Intergenic
1193376334 X:80766309-80766331 AGCTGAAGACCCAGGAAAGCTGG - Intronic
1193565047 X:83065723-83065745 GTCTGATGTCCAAGGGCAGGAGG + Intergenic
1195300993 X:103529815-103529837 GACGGAAGGCCAAGGGGAGCTGG - Intergenic
1195571672 X:106403899-106403921 AGCTGAAGTCAAAGGGAAGCTGG + Intergenic
1195582011 X:106515454-106515476 AGCTGAAGACCAGGGGCAGGGGG + Intergenic
1196343525 X:114625156-114625178 GGCAGAATACTAAGGGGAGCTGG - Intronic
1199052612 X:143254345-143254367 GGCTGAAGATCAAGTACAGCCGG - Intergenic
1199252157 X:145675888-145675910 GTGGGAAGATCAAGGGCAGCTGG - Intergenic
1199820410 X:151440042-151440064 GGCTGAAGGCAAAGGGAAGAAGG - Intergenic
1199947463 X:152680362-152680384 GGATGAAGACTCAGGTCAGCAGG + Intergenic
1199962217 X:152788092-152788114 GGATGAAGACTCAGGTCAGCAGG - Intergenic
1200234532 X:154461880-154461902 GGCTCAAGACAAGGGGCAACCGG - Intronic