ID: 984646948

View in Genome Browser
Species Human (GRCh38)
Location 4:182230868-182230890
Sequence TGTAATTATCGGAGAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984646948_984646955 15 Left 984646948 4:182230868-182230890 CCTCCTGTTCTCCGATAATTACA 0: 1
1: 0
2: 0
3: 1
4: 79
Right 984646955 4:182230906-182230928 GGTTTCCCCAGCAACGGAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 106
984646948_984646953 9 Left 984646948 4:182230868-182230890 CCTCCTGTTCTCCGATAATTACA 0: 1
1: 0
2: 0
3: 1
4: 79
Right 984646953 4:182230900-182230922 GAGGCAGGTTTCCCCAGCAACGG No data
984646948_984646954 14 Left 984646948 4:182230868-182230890 CCTCCTGTTCTCCGATAATTACA 0: 1
1: 0
2: 0
3: 1
4: 79
Right 984646954 4:182230905-182230927 AGGTTTCCCCAGCAACGGAGTGG No data
984646948_984646951 -10 Left 984646948 4:182230868-182230890 CCTCCTGTTCTCCGATAATTACA 0: 1
1: 0
2: 0
3: 1
4: 79
Right 984646951 4:182230881-182230903 GATAATTACAGCACACGAAGAGG 0: 1
1: 0
2: 1
3: 4
4: 91
984646948_984646952 -6 Left 984646948 4:182230868-182230890 CCTCCTGTTCTCCGATAATTACA 0: 1
1: 0
2: 0
3: 1
4: 79
Right 984646952 4:182230885-182230907 ATTACAGCACACGAAGAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984646948 Original CRISPR TGTAATTATCGGAGAACAGG AGG (reversed) Intronic
905289805 1:36913407-36913429 AGTAATAAACGCAGAACAGGGGG - Intronic
911970703 1:104432288-104432310 TTTAATTATCTGTGAACAAGTGG - Intergenic
914326928 1:146627361-146627383 TGTAAGTATTGGTGAAAAGGTGG + Intergenic
1065988385 10:30980673-30980695 TGTAAATTTGGGAGAACAGATGG + Intronic
1075708818 10:124519456-124519478 AGTAGTTTTTGGAGAACAGGTGG + Intronic
1079660118 11:23027506-23027528 TGTAACTATGGAAAAACAGGAGG - Intergenic
1085094575 11:73749484-73749506 AGTAGTTTTCGGGGAACAGGTGG - Intronic
1085882063 11:80479332-80479354 TCTAAATATCGGACAACAGAAGG - Intergenic
1090483692 11:127091793-127091815 AGTAGTTTTGGGAGAACAGGTGG - Intergenic
1091512573 12:1144270-1144292 AGTAGTTTTTGGAGAACAGGTGG + Intronic
1092367945 12:7892554-7892576 TGTCATTATTGGAGAAGAGTGGG - Intergenic
1092466773 12:8740361-8740383 AGTAGTTTTTGGAGAACAGGTGG + Intronic
1098280771 12:68860827-68860849 TGTAAGTAACACAGAACAGGAGG + Intronic
1099117050 12:78640671-78640693 TGTAATAATCAGAAAACAAGAGG - Intergenic
1104833337 12:131770236-131770258 TGAAATTCTCGGAGTCCAGGAGG + Intronic
1108021157 13:46128935-46128957 AGTAATTTTAGGAGAGCAGGAGG - Intronic
1112095268 13:96126096-96126118 TATAATTATGAGAGATCAGGAGG - Intronic
1112137057 13:96591734-96591756 TGTAATAATGGTAGAAAAGGGGG + Intronic
1115414911 14:33120963-33120985 AGTAATTATCACCGAACAGGAGG - Intronic
1119645907 14:76348341-76348363 TGTACTTACAGGACAACAGGAGG + Intronic
1121148237 14:91605319-91605341 TGTTATTATTGGGGAAGAGGAGG + Intronic
1127534289 15:59875356-59875378 GGTAATTATTGGACTACAGGAGG + Intergenic
1128553067 15:68610535-68610557 TGGAAGGATGGGAGAACAGGAGG - Intronic
1130842509 15:87714523-87714545 TCTAATTATCTGAGCAAAGGAGG - Intergenic
1131902513 15:97103850-97103872 TGTAACTATCGCTGAAAAGGCGG + Intergenic
1136988773 16:35139547-35139569 CATAATTAACGCAGAACAGGAGG - Intergenic
1138063199 16:53912995-53913017 TATAATTATCTGAGAGCTGGGGG + Intronic
1140006633 16:71083579-71083601 TGTAAGTATTGGTGAAAAGGTGG - Intronic
1140040618 16:71405160-71405182 TGTAAGTATCGCAGCAAAGGAGG + Intergenic
1145010297 17:19364137-19364159 TGTAGTTATCGAATAACTGGGGG + Intronic
1156095442 18:33525984-33526006 AGTAGTTTTGGGAGAACAGGTGG + Intergenic
1156232692 18:35169828-35169850 TGTCATCAGCTGAGAACAGGAGG - Intergenic
1167867982 19:52343780-52343802 TGTGATCATTGGAGAACAGCTGG + Intronic
925385447 2:3458750-3458772 TGTAGTTATCAGAGAGCAGAAGG + Intronic
927654947 2:24937177-24937199 TTTAATAATCTAAGAACAGGTGG - Intergenic
929544203 2:42845064-42845086 TGTTATTCTCTGAGGACAGGCGG + Intergenic
938795695 2:134717364-134717386 TCTAGTTATGTGAGAACAGGGGG + Intronic
939960528 2:148561493-148561515 TGTAATTACCGGAGGTCAGAGGG - Intergenic
942263414 2:174194661-174194683 TGTAATTAAAGGAGAATATGGGG - Intronic
1170172170 20:13427464-13427486 GGTAATTATGTGAGAACATGCGG + Intronic
1172631599 20:36382100-36382122 TGCAATTATGGGAGATCTGGAGG + Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
957721107 3:84000401-84000423 AGTAATTTTTGGGGAACAGGTGG + Intergenic
975763342 4:77640138-77640160 AGTAATTTTTGGGGAACAGGTGG + Intergenic
979898210 4:126187540-126187562 TGTAATGTTGTGAGAACAGGAGG + Intergenic
982752780 4:159182167-159182189 TGGAAATATCGGAGTACAGATGG + Intronic
984646948 4:182230868-182230890 TGTAATTATCGGAGAACAGGAGG - Intronic
986238073 5:5930677-5930699 TGTAATTATGGTTGAACAGTTGG + Intergenic
987617457 5:20295157-20295179 TGTAATTATCTTAGAACATCAGG + Intronic
987822124 5:22979076-22979098 TTAAATTTTTGGAGAACAGGTGG - Intergenic
990956799 5:61348969-61348991 TGTAAAAATCGGAGAAAATGAGG + Intronic
993209384 5:84928659-84928681 CCTAACTATCAGAGAACAGGTGG - Intergenic
994407578 5:99364458-99364480 TGTAATTACCTGAACACAGGTGG - Intergenic
995703063 5:114957266-114957288 TGTAATTTTCAGAGAACTGAAGG + Intergenic
1004101644 6:12618121-12618143 AATAATTTTTGGAGAACAGGTGG - Intergenic
1005443320 6:25895270-25895292 TGAATTTCTCAGAGAACAGGTGG - Intergenic
1009391966 6:63155392-63155414 AGTAAGTGTCGGAGAACAGAAGG - Intergenic
1018565570 6:165147541-165147563 TGTAATTATAGGGGAACACTGGG - Intergenic
1021117147 7:16756716-16756738 TGTAAATATAGAAGAAAAGGGGG + Intronic
1021650775 7:22830943-22830965 TGTAATTAGCAGAGACCATGGGG - Intergenic
1023491738 7:40750203-40750225 TGTGATTATCAGAGAAATGGAGG - Intronic
1030279103 7:107751813-107751835 TTTAATGATGGGAGTACAGGTGG + Intronic
1031562967 7:123260472-123260494 TGTAATCATGGGACAATAGGGGG - Intergenic
1035340094 7:158154587-158154609 GGTAAAGATCAGAGAACAGGAGG + Intronic
1037453253 8:19038127-19038149 TGTAATTATCAGCCAACATGTGG + Intronic
1037711625 8:21359870-21359892 TGTGCTTCTCTGAGAACAGGTGG - Intergenic
1041101039 8:54396654-54396676 TGTTATTCTCGGGGAACACGGGG + Intergenic
1045570120 8:103360099-103360121 TGTAATGATTGGACAACTGGAGG + Intergenic
1046188678 8:110759925-110759947 GGAAATTATCGCAGAAGAGGGGG - Intergenic
1048000698 8:130377352-130377374 TTTAATTTTTGGGGAACAGGTGG - Intronic
1048371217 8:133778058-133778080 AATAATTTTCGGAGAACAGGGGG + Intergenic
1048935995 8:139357524-139357546 TGTAATTCTCTGAGCAAAGGAGG + Intergenic
1060004003 9:119983582-119983604 TGTAATTGTCTGAGAAAAGAGGG + Intergenic
1185667423 X:1777115-1777137 AGTCATTTTTGGAGAACAGGTGG + Intergenic
1187636982 X:21239433-21239455 AATAGTTTTCGGAGAACAGGTGG - Intergenic
1188575154 X:31640072-31640094 TGTGACTATCGGTGAACCGGAGG + Intronic
1189671006 X:43408560-43408582 TGTTATTATTGGGGAATAGGAGG + Intergenic
1190495311 X:51022967-51022989 TGGAACTACCGGACAACAGGTGG + Intergenic
1191128420 X:56982697-56982719 TGTCATTCTGGGGGAACAGGAGG + Intronic
1201983876 Y:19940169-19940191 AGTAGTTTTGGGAGAACAGGTGG - Intergenic
1202058802 Y:20864423-20864445 TGTAATTATAGGGGAAAAGTAGG - Intergenic