ID: 984647869

View in Genome Browser
Species Human (GRCh38)
Location 4:182238852-182238874
Sequence TATGAATGAGTCACCGCGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984647869_984647871 22 Left 984647869 4:182238852-182238874 CCTACCGCGGTGACTCATTCATA 0: 1
1: 0
2: 0
3: 2
4: 149
Right 984647871 4:182238897-182238919 AAACAAGCAAGAGAAAACAGAGG 0: 1
1: 0
2: 6
3: 127
4: 1289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984647869 Original CRISPR TATGAATGAGTCACCGCGGT AGG (reversed) Intronic
901042759 1:6375388-6375410 TAGGCATGAGTCACCGCGCCTGG - Intronic
902789786 1:18759782-18759804 CAGGAATGAGCCACCGCGTTGGG + Intergenic
910062151 1:83106751-83106773 TAGGCATGAGCCACCGTGGTGGG - Intergenic
911865037 1:103007578-103007600 TAGGAATGATTCACCGCGCTGGG - Intronic
913291753 1:117279678-117279700 TAGGCATGAGTCACCGCGCCTGG + Intergenic
915197726 1:154202521-154202543 CAGGCATGAGTCACCGCGGCCGG - Intronic
917757756 1:178119779-178119801 GATTAGTGAGTCACCGTGGTAGG - Intronic
919631614 1:199965289-199965311 TAGGCATGAGCCACCGCGCTGGG + Intergenic
919910650 1:202108591-202108613 TGTCAGTGAGTCACAGCGGTTGG - Intergenic
920527754 1:206680476-206680498 TATGAATGAGTGACAGAGGGTGG - Intronic
922542766 1:226431432-226431454 TAGGAATGAGTCACTGCGCCCGG + Intergenic
1063491759 10:6470671-6470693 TAGGCATGAGCCACCGCGCTTGG - Intronic
1072171878 10:92871247-92871269 TAGGCATGAGTCACCGTGCTAGG - Intronic
1073899887 10:108207757-108207779 TATGCATGAGTCACCGCACCTGG - Intergenic
1075615520 10:123888375-123888397 TATGTATGAGGCACTGAGGTGGG - Intronic
1079695036 11:23471596-23471618 TAGGCATGAGTCACCGCGCCTGG - Intergenic
1080185587 11:29481165-29481187 TTTGAATGAGTCACTGAGGATGG - Intergenic
1081717594 11:45261636-45261658 TAGGCATGAGTCACCGTGGCTGG - Intronic
1085344622 11:75760199-75760221 TACGATTGAGTCACCGAGGAGGG - Intronic
1086624546 11:88930828-88930850 CATGAATGAGTCACCACACTCGG + Intronic
1088297734 11:108318896-108318918 TAGGCATGAGCCACCGCGCTCGG - Intronic
1091427861 12:407027-407049 TAGGCATGAGTCACTGCGCTTGG - Intronic
1092785190 12:12020079-12020101 TAGGTATGAGTCACCGCGCCTGG + Intergenic
1094043106 12:26137941-26137963 TAGGCATGAGTCACCGCGTCTGG + Intronic
1094711841 12:32972014-32972036 TAGGCATGAGCCACCGCGGCTGG + Intergenic
1098865486 12:75758176-75758198 TAGGCATGAGTCACCGCGCCCGG - Intergenic
1098971013 12:76857050-76857072 TAAGAATGAGTCACTAAGGTGGG + Intergenic
1099791876 12:87346292-87346314 CAGGCATGAGTCACCGCGGCCGG - Intergenic
1100538934 12:95539501-95539523 TAGGCATGAGTCACCGCGCCCGG + Intronic
1107799659 13:44093423-44093445 TAGGCATGAGCCACCGCGCTGGG + Intergenic
1108277291 13:48823680-48823702 TATGCATGAGCCACCGCGCCCGG + Intergenic
1109833919 13:67829850-67829872 CATGAATGAGTCACCGTGCCTGG + Intergenic
1114997589 14:28375874-28375896 TAGGCATGAGCCACCGCGCTCGG - Intergenic
1117550178 14:56827909-56827931 TATGCATGAGCCACCGCGCCCGG - Intergenic
1119337448 14:73845962-73845984 TATGCATGAGCCACCGCGCCTGG - Intergenic
1120497187 14:85252224-85252246 TATGAATGAGTTATCACTGTGGG + Intergenic
1125625544 15:41106114-41106136 CAGGCATGAGTCACTGCGGTTGG - Intronic
1125700584 15:41679319-41679341 TAGGCATGAGCCACCGCGCTGGG + Intronic
1125816488 15:42589327-42589349 TAGGCATGAGTCACCACGCTTGG + Intronic
1127121963 15:55779682-55779704 TAGGCATGAGCCACCGTGGTGGG - Intergenic
1127989426 15:64101077-64101099 TATGCGTGAGTCACCACGCTTGG + Intronic
1130050813 15:80482185-80482207 TAGGCATGAGCCACCGCAGTGGG + Intronic
1132486378 16:194078-194100 TAGGCATGAGCCACCGCGCTTGG + Intronic
1132490149 16:224239-224261 TAGGCATGAGCCACCGCGCTCGG - Intronic
1133366529 16:5214786-5214808 TATGAAAGATTCACCTTGGTTGG + Intergenic
1134132146 16:11657237-11657259 TAGGTGTGAGCCACCGCGGTGGG + Intergenic
1135041504 16:19120743-19120765 TGTGAGTGAGCCACCGCGGCCGG + Exonic
1136490847 16:30607313-30607335 TAGGAATGAGCCACTGCGCTTGG - Intronic
1136948860 16:34690637-34690659 TAGGCATGAGCCACCGCGCTGGG + Intergenic
1136968268 16:34941284-34941306 TAGGCATGAGCCACCGCGCTGGG + Intergenic
1139823692 16:69740508-69740530 TAGGCATGAGTCACCGTGCTCGG + Intergenic
1140468773 16:75203287-75203309 TAGGCATGAGCCACCGCGCTCGG - Intergenic
1142838852 17:2611190-2611212 TAGGCATGAGTCACCGCGCCTGG - Intronic
1142950740 17:3477729-3477751 TAGGCATGAGCCACCGCGCTGGG + Intronic
1143209315 17:5172252-5172274 TAGGCATGAGCCACCGCGCTCGG - Intronic
1143521990 17:7449685-7449707 TAGGCATGAGCCACCGCGCTCGG + Intronic
1147013006 17:37466876-37466898 TAGGAATGAGCCACCGCACTGGG - Intronic
1148034908 17:44652930-44652952 CAGGCATGAGTCACCGCGCTTGG - Intergenic
1150356400 17:64489481-64489503 TAAGAATGAGTCACCATGTTTGG - Intronic
1153251410 18:3125989-3126011 TAGGCATGAGCCACCGCGGCCGG - Intronic
1158332179 18:56374959-56374981 CATGCGTGAGTCACCGCGTTTGG + Intergenic
1162132264 19:8533905-8533927 TATGCATGAGCCACCGCGCCCGG - Intronic
1162155361 19:8674115-8674137 CAGGAATGAGCCACCGCGCTTGG + Intergenic
1162189021 19:8930214-8930236 TATGGTTGAGTCTCCGCAGTGGG - Intronic
1163070050 19:14832185-14832207 TAGGCATGAGTCACCTCGCTTGG + Intronic
1163565043 19:18046183-18046205 TAGGCATGAGTCACCGCGCCTGG + Intergenic
1163691447 19:18740724-18740746 CAGGAATGAGTCACCGCGCCTGG - Intronic
1163853691 19:19682515-19682537 TAAGAATGAGTCACAGGGGCCGG - Exonic
1165698139 19:37916680-37916702 CAGGCATGAGTCACCGCGCTCGG - Intronic
1166135335 19:40773639-40773661 TAGGAGTGAGTCACCGCGTCTGG - Intronic
1166746499 19:45144423-45144445 TATGAGTGAGTCACCGTGCCTGG + Intronic
1167847001 19:52172837-52172859 TAGGCATGAGCCACCGCGCTTGG - Intergenic
1168422761 19:56215926-56215948 CAGGCATGAGCCACCGCGGTTGG + Intergenic
1202682293 1_KI270712v1_random:18025-18047 TAGGCATGAGCCACCGCGGTGGG + Intergenic
944301179 2:198126625-198126647 CAGGAATGAGCCACCGCGCTTGG - Intronic
946045291 2:216815981-216816003 TATGAACTAGTCACCACTGTAGG - Intergenic
1173718022 20:45228060-45228082 TAGGCATGAGCCACCGCGCTTGG - Intergenic
1174275394 20:49400038-49400060 CAGGAATGAGTCACCGCGCCTGG + Intronic
1174832146 20:53823010-53823032 TAGGCATGAGCCACCGCGCTGGG - Intergenic
1177677091 21:24315064-24315086 TAGGCATGAGCCACCGCGCTGGG - Intergenic
1178475548 21:32934278-32934300 TAGGAATGAGCCACCGCGCCCGG + Intergenic
1179604982 21:42509337-42509359 AATGACTGAGTCACCGTGGGTGG - Intronic
1182336671 22:29588115-29588137 TGTGAATGACTCACCGTGGAAGG - Intergenic
1182896722 22:33864996-33865018 TCTGAAAGAGTCACAGCCGTGGG + Intronic
1185099323 22:48829089-48829111 GATGAATGAGTCACTGAGTTTGG - Intronic
957440566 3:80241493-80241515 CATGAATGAGTCACCGCACCTGG + Intergenic
957662387 3:83177516-83177538 CAGGAGTGAGTCACCGCGCTCGG - Intergenic
958917968 3:100070906-100070928 TAGGCATGAGTCACCGCGCCTGG + Intronic
961479957 3:127173257-127173279 CATGCATGAGTCATCGGGGTGGG + Intergenic
962393973 3:134998784-134998806 TATGAATGAGACACTGTGTTAGG - Intronic
962761272 3:138517390-138517412 CAGGCATGAGTCACCGCGCTTGG - Intronic
967528363 3:190520214-190520236 TATGTATGAGTCACTGTGCTAGG - Intronic
968508589 4:984551-984573 TAGGCATGAGCCACCGCGCTGGG - Intronic
969080294 4:4612637-4612659 TATGAATGAGTAAACGAGCTTGG + Intergenic
969082037 4:4626525-4626547 TAGGCATGAGTCACCGCGCCTGG + Intergenic
972431626 4:38988507-38988529 CAGGCATGAGTCACCGCGCTCGG + Intronic
974124997 4:57685302-57685324 CAGGAATGAGCCACCGCGGCTGG - Intergenic
975132113 4:70840332-70840354 TACGAATGAGTCACTGCGCCAGG - Intergenic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
984647869 4:182238852-182238874 TATGAATGAGTCACCGCGGTAGG - Intronic
985050210 4:185982742-185982764 CATGCATGAGTCACCGCGCCCGG + Intergenic
988987949 5:36638941-36638963 TAGGCATGAGTCACCGCGCCTGG + Intronic
993865401 5:93188612-93188634 TATGCATGTGTCATGGCGGTTGG - Intergenic
994134359 5:96268293-96268315 TAGGAATGAGCCACTGCAGTTGG - Intergenic
995121714 5:108542877-108542899 TGGGAATGAGTCACCGCGCCCGG + Intergenic
999565832 5:152860319-152860341 CATGAATGAAACACCACGGTAGG + Intergenic
999808259 5:155103975-155103997 TAGGCATGAGCCACCGCGGCCGG + Intergenic
1000093126 5:157947366-157947388 TAGGCATGAGTCACCACGGCTGG + Intergenic
1004359635 6:14959788-14959810 CAGGAATGAGGCACCGCGGCTGG - Intergenic
1005029307 6:21494114-21494136 TAGGCATGAGTCACCGCGCCCGG - Intergenic
1005555207 6:26972569-26972591 TAGGAATGAGTCACAGCAGCAGG + Intergenic
1005561644 6:27046867-27046889 TAGGAATGAGCCACCGCGCCCGG - Intergenic
1006179402 6:32145350-32145372 TATGTGTGAGCCACCGCGCTCGG + Intergenic
1009728353 6:67563202-67563224 TAGGAATGAGCCACCGCGCCTGG + Intergenic
1010452439 6:76018018-76018040 CAGGCATGAGCCACCGCGGTTGG + Intronic
1012003347 6:93681889-93681911 CATGCATGAGCCACCGTGGTTGG + Intergenic
1013609354 6:111779594-111779616 TAAGAATGGGTCACCAGGGTTGG + Intronic
1014145055 6:117987969-117987991 TATGAATGGCCCACCGCTGTTGG - Intronic
1014726852 6:124981739-124981761 TAGGCATGAGTCACCGCCCTCGG - Intronic
1019681170 7:2350524-2350546 TAGGCATGAGCCACCGCGCTCGG - Intronic
1022340362 7:29461896-29461918 TATGTATGAGACACTGCTGTAGG - Intronic
1023062323 7:36340143-36340165 TAGGCATGAGCCACCGCGCTTGG + Intronic
1023746080 7:43323748-43323770 TAGGCATGAGTCACCGCGCACGG - Intronic
1025837855 7:65112432-65112454 TAGGCATGAGCCACCGCGCTGGG + Intergenic
1026330274 7:69346126-69346148 TAGGCATGAGTCACCGCGACCGG - Intergenic
1029614356 7:101646827-101646849 TAGGAATGAGCCACCGCGCCTGG - Intergenic
1030150042 7:106395247-106395269 TAGGCATGAGCCACCGCGCTTGG - Intergenic
1031348528 7:120699395-120699417 TTTGTATGAGTCACTGTGGTAGG + Intronic
1031681188 7:124676452-124676474 CAGGAATGAGTCACCGCGCCAGG + Intergenic
1033585424 7:142771212-142771234 TATGGATGAATAACAGCGGTGGG - Intergenic
1035474708 7:159134932-159134954 CAGGAATGAGTCACCGCGCCTGG + Intronic
1035946682 8:3971026-3971048 TAGGCATGAGTCACCGCGCCCGG + Intronic
1038012358 8:23485191-23485213 TAGGCGTGAGTCACCGCGCTGGG + Intergenic
1038060533 8:23907394-23907416 TCTGAATGAGGAACCGCTGTAGG - Intergenic
1038653863 8:29430739-29430761 CATGCATGAGGCACCGCGCTTGG + Intergenic
1041098008 8:54368565-54368587 TAGGCATGAGCCACCGCGGCCGG - Intergenic
1047902372 8:129437096-129437118 TGTGAATGAGTCACCTCCTTGGG + Intergenic
1049137019 8:140911953-140911975 TAGGCATGAGTCACCGCGCCTGG - Intronic
1049266368 8:141670024-141670046 TCTGGAGGAGTCACCGCGATGGG - Intergenic
1056515888 9:87349688-87349710 CAGGCATGAGTCACCGCGGCTGG - Intergenic
1057062998 9:92021937-92021959 CAGGCATGAGTCACTGCGGTCGG + Intergenic
1058682251 9:107450256-107450278 CAAGAATGAGCCACCGCGCTCGG + Intergenic
1060454790 9:123781790-123781812 TAGGCATGAGTCACCGTGCTCGG - Intronic
1060576059 9:124695645-124695667 TAGGCATGAGTCACCGCGCCCGG + Intronic
1061356006 9:130105532-130105554 TAGGCATGAGTCACCGCAGCTGG + Intronic
1061730444 9:132609895-132609917 TAAGAGTGAGTCACCGCGCCTGG + Intronic
1186779146 X:12895596-12895618 TAGGCATGAGTCACCGCGCCTGG + Intergenic
1189700988 X:43716211-43716233 CAGGAATGAGCCACCGAGGTTGG + Intronic
1191769506 X:64740174-64740196 TATAAGTGAGTCACCACGGAGGG - Intergenic
1194356059 X:92885232-92885254 TAGGCATGAGCCACCGCGCTTGG + Intergenic
1194749775 X:97671241-97671263 TATAAATGAGTCACAAGGGTGGG + Intergenic
1197279561 X:124519084-124519106 TATGGCTGAGTCACCACTGTGGG + Intronic