ID: 984652469

View in Genome Browser
Species Human (GRCh38)
Location 4:182285426-182285448
Sequence CAGTATCAGCAGACACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984652469_984652474 12 Left 984652469 4:182285426-182285448 CCACTATGTGTCTGCTGATACTG 0: 1
1: 0
2: 2
3: 20
4: 137
Right 984652474 4:182285461-182285483 ACAACTGAAACTATAAGACCAGG 0: 1
1: 0
2: 1
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984652469 Original CRISPR CAGTATCAGCAGACACATAG TGG (reversed) Intronic
900580457 1:3406054-3406076 CAGTCTCAGCAGACACCCACTGG + Intronic
900994043 1:6110700-6110722 CAGTATCAGCAGACACTGACAGG + Intronic
908333625 1:63097401-63097423 CAGTATGAGCAAAGACATCGAGG + Intergenic
908844271 1:68308893-68308915 CAGTGCCAGCAGATACACAGTGG - Intergenic
909516399 1:76511971-76511993 CAGTATCACATGACACACAGAGG - Intronic
910088294 1:83430746-83430768 CAGTGTGATCAGACACATTGGGG + Intergenic
914906391 1:151749524-151749546 CAGTATCAGTAGACACCATGTGG - Intergenic
915007217 1:152649853-152649875 AAATAGCAGCAGACAGATAGGGG + Intergenic
915638114 1:157200408-157200430 CAGTCTCAGGAGACTCACAGAGG - Intergenic
917526547 1:175793299-175793321 CAGTGTCAACAGCCACAGAGAGG + Intergenic
917845304 1:179015376-179015398 CAGTATGAACAGAGACATGGAGG - Intergenic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918505432 1:185249083-185249105 CACTATCTCCAGACACTTAGAGG + Intronic
920050695 1:203162959-203162981 CTGTCTCAGCAGCCACACAGCGG - Intronic
920967504 1:210713309-210713331 CAATATCAGCAGACACAGATTGG + Intronic
922050274 1:221982757-221982779 TAGTATCAGCAGATGGATAGAGG - Intergenic
1064102136 10:12472988-12473010 CAGGATGAGCAGAAACACAGAGG + Intronic
1064902813 10:20313075-20313097 CAGCATCACCATACACATAAGGG + Intergenic
1067838108 10:49654070-49654092 CAGATTCAGCAGAAACCTAGAGG + Intronic
1069253768 10:66305950-66305972 CAGTATCCAAAGTCACATAGCGG + Intronic
1071735327 10:88292514-88292536 CAGTATCAGGAGACTCATATTGG - Intronic
1072829452 10:98642130-98642152 CAGTATTAGCCCACAAATAGTGG - Intronic
1073068198 10:100776625-100776647 CTGCATCAGCAGGCACACAGAGG - Intronic
1075249424 10:120852173-120852195 CAGTATCCCCAGGCACATTGTGG + Intronic
1075558554 10:123450613-123450635 CAGAAGCAGGACACACATAGTGG + Intergenic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1080140485 11:28912793-28912815 CAGTCTTACCAGACTCATAGTGG + Intergenic
1082230165 11:49754638-49754660 AAGTATCAGAACACACATTGGGG - Intergenic
1083051002 11:59776521-59776543 CATGATCACCAGTCACATAGAGG - Intronic
1085742606 11:79089814-79089836 AAATATCACCAGACACCTAGTGG - Intronic
1085779862 11:79398291-79398313 CAGGAGCAGCAGACAAGTAGGGG + Intronic
1086482429 11:87256807-87256829 CAGGACCAACAGACAGATAGAGG - Intronic
1087474919 11:98622949-98622971 TGGCATCAGCAGACACAGAGTGG - Intergenic
1087984436 11:104659724-104659746 CTCTACCAGCAGACACAAAGTGG + Intergenic
1089368606 11:117936880-117936902 CAGTGTCAGCTGGCACAGAGAGG + Intergenic
1090525125 11:127525644-127525666 CAGTAACAGCAGTCAAATAGAGG - Intergenic
1091843736 12:3638636-3638658 CAGTGGCAGCAGGCACTTAGTGG - Intronic
1093862169 12:24179593-24179615 CAGAATCAGGAGACACAGATGGG - Intergenic
1094640789 12:32273390-32273412 AAGTACCAGCAGACACAGAGGGG + Intronic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1102668253 12:114595220-114595242 CAGTATAAACATACACATATAGG - Intergenic
1104476514 12:129074735-129074757 CAGTGACAGCAGACACACAGGGG - Exonic
1106845750 13:33736233-33736255 AAGTATCAGCAGCCACCCAGAGG - Intergenic
1113294330 13:108941277-108941299 CAGTTTCAGGAGACAGATCGAGG + Intronic
1113647380 13:112008442-112008464 CAGCATCAGCAAACAGACAGGGG + Intergenic
1115644198 14:35356063-35356085 AAGCAGTAGCAGACACATAGTGG + Intergenic
1117018161 14:51540140-51540162 CAGAATCAGGAGAAACATTGAGG + Intronic
1118604766 14:67494699-67494721 CAGAATCAGCATTCACAGAGAGG + Intronic
1120906317 14:89624283-89624305 CAGTTGCAGTAGACACAAAGCGG + Intergenic
1122471428 14:101969538-101969560 CAGCTCCAGCAGACACAAAGAGG + Intronic
1122476459 14:102013419-102013441 TAGTTTGAGCAGACACTTAGGGG + Intronic
1124396067 15:29303020-29303042 CAGTCTGAGCAGACTCAAAGGGG + Intronic
1124721567 15:32115328-32115350 CAATTTCAGCAGGCACATGGCGG - Intronic
1128106013 15:65045436-65045458 CAGTAACAGCTGTCACTTAGGGG - Exonic
1128146620 15:65335531-65335553 CAACATCAGCAGACACACACTGG + Intronic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1140703055 16:77600412-77600434 AAGTCTCAGCAAAGACATAGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143148847 17:4794627-4794649 CAGTATAAAAAGACAAATAGAGG + Intergenic
1143429776 17:6872582-6872604 CAGGATCAACAGACATATTGGGG - Intergenic
1151039827 17:70845946-70845968 TAGTCTCAGCAAAGACATAGAGG + Intergenic
1155573532 18:27220811-27220833 AAGTACCAGCAGACCCCTAGAGG + Intergenic
1155897334 18:31346558-31346580 CAGGATAAGCAAACACATGGAGG - Intronic
1157459899 18:47881382-47881404 TACTAGCAGCAGACAAATAGGGG - Intronic
1159669001 18:71200021-71200043 CAGTTTTAGCAGAATCATAGTGG + Intergenic
1164479036 19:28597560-28597582 CAGTCTCTGTGGACACATAGTGG + Intergenic
1166255480 19:41601418-41601440 CTGTATCAGCAGACATGTATTGG - Intronic
925338031 2:3112802-3112824 CATTATCACCAGGCACATGGGGG + Intergenic
926343198 2:11921863-11921885 CAGAGTCAGGAGAAACATAGAGG - Intergenic
930994870 2:57704314-57704336 CAGTATTAGCAGACACAAAGTGG - Intergenic
931880578 2:66565749-66565771 CATTATCTGCAGACTCTTAGAGG - Intronic
932716431 2:74103165-74103187 CAGTATCAGCATAGACTTTGGGG - Exonic
933354701 2:81196880-81196902 TAATATCAGCAGAGACCTAGCGG + Intergenic
934219080 2:90065007-90065029 CAGTGTCAGCACAGACAAAGTGG + Intergenic
936024626 2:109021796-109021818 CAGCAGAAGCAGACAAATAGCGG + Intergenic
937327084 2:120996447-120996469 CAGACTCAGCAGACAGATGGAGG - Intergenic
939426896 2:142050995-142051017 AAGTATCAGCAAACACATAATGG + Intronic
940623606 2:156145233-156145255 CAGTATCACCAAACAAATATGGG + Intergenic
942090583 2:172486223-172486245 CAGTACCAGCAGCCCCATAGTGG - Intronic
942641043 2:178060657-178060679 CAGTAACAACAGACGCATAAGGG - Intronic
943290211 2:186061463-186061485 AAGTGTCAGCAGATTCATAGAGG + Intergenic
1168819186 20:761809-761831 CAGGAACAGCAGAGACCTAGAGG + Exonic
1171433962 20:25104800-25104822 CTGCATCTGCAGCCACATAGTGG + Intergenic
1180089863 21:45528404-45528426 CAGAGTCAGGAGACACACAGGGG + Intronic
1180646356 22:17342322-17342344 CAGGGTCAGCAGACACACGGAGG + Intergenic
1183190357 22:36318530-36318552 CAGACTCAGCAGCCACATACAGG + Intronic
1183404085 22:37621599-37621621 CAGCATCTGCAGAGACAGAGGGG - Exonic
950507998 3:13407600-13407622 CAGCATCAGCAGAGGAATAGAGG - Intronic
953832456 3:46312215-46312237 CAGTATTAGCAGAAACTTAGTGG - Intergenic
958533576 3:95366281-95366303 CAGTATCAGCAGACCTCTAGAGG + Intergenic
959266382 3:104145564-104145586 CACTACCAGCAGACACAGTGGGG + Intergenic
961595443 3:128012269-128012291 CAGCATCACCACACACAGAGAGG - Intergenic
961979281 3:131059772-131059794 CTGTATTGACAGACACATAGAGG + Intronic
963838023 3:150076647-150076669 CAGTCTCAGCAGACACCATGTGG + Intergenic
965348473 3:167582564-167582586 AAGAATAAACAGACACATAGTGG - Intronic
966855502 3:184191216-184191238 CGAGATCAGCAGACACAGAGAGG - Exonic
967415293 3:189210614-189210636 CAGTATCACCAGAGACTTTGTGG - Intronic
970481920 4:16484832-16484854 CAGTATTTGCAGACACATGGGGG - Intergenic
970551327 4:17184739-17184761 CAGTATCACCAGAAACTTGGTGG - Intergenic
971895976 4:32594631-32594653 CAGTAGGAGAAGACACAGAGTGG - Intergenic
977532216 4:98213687-98213709 CAGTGTGAACAGACATATAGCGG - Intergenic
981309019 4:143277889-143277911 CAGTGTCAGCAGACACATTGGGG - Intergenic
981436737 4:144732504-144732526 GAGTATCAGCAGAGAAACAGGGG + Intronic
983468591 4:168127080-168127102 CAGTATGCCCAGACACATTGGGG - Intronic
984652469 4:182285426-182285448 CAGTATCAGCAGACACATAGTGG - Intronic
984689191 4:182706569-182706591 CAAAAGCTGCAGACACATAGAGG + Intronic
986195442 5:5533432-5533454 CAGTGTCAGCAGACACTCAGTGG + Intergenic
986258530 5:6122622-6122644 AATTATCAACAGACCCATAGAGG + Intergenic
987798156 5:22656473-22656495 CTGTATGAGCATAGACATAGTGG + Intronic
988090470 5:26533108-26533130 CACTACCAGGAGACAAATAGGGG + Intergenic
989578399 5:43010063-43010085 CAGTTCCAGCAGACACAGGGAGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
991443967 5:66680428-66680450 CACTGGCAGCAGACACAGAGGGG - Intronic
997801718 5:136869437-136869459 CAGAAGCAGCTGACTCATAGAGG + Intergenic
1000058894 5:157635084-157635106 AATTATCATCAGACACATACAGG + Intronic
1001130648 5:169060868-169060890 CAGCATGAGCAGACAGCTAGAGG - Intronic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1001960013 5:175874245-175874267 CATTAGCAGCAGTCACAGAGTGG + Intronic
1006244978 6:32725066-32725088 CAGTAGTAGCAGACACATGTTGG + Intergenic
1006966498 6:37991235-37991257 CAGTCTCCACAGACACACAGAGG - Intronic
1007290447 6:40782272-40782294 AACTGTCAACAGACACATAGTGG + Intergenic
1010142543 6:72627784-72627806 CAGCATGAGCAAACACATGGTGG - Intronic
1013504229 6:110783207-110783229 CAGGAACAGCAGACAAATATAGG + Intronic
1014563690 6:122921940-122921962 CATTATCAGCAGTCAAATATGGG - Intergenic
1015277521 6:131399555-131399577 CAGAATCAGCAGATTCACAGAGG + Intergenic
1015512650 6:134054047-134054069 CACTATCAGCAGACATACAACGG - Intergenic
1016235248 6:141856231-141856253 CAGTATCTGAAGAAACATACAGG - Intergenic
1016485188 6:144529397-144529419 CAGCATGTGCAGACACATAGTGG - Intronic
1018790371 6:167143600-167143622 CAGTAGCACCAGGCACATGGAGG - Intergenic
1022536088 7:31099533-31099555 CAGAATCAGCACATACATAGGGG - Intronic
1023191650 7:37589638-37589660 CAGTATCAGCAAACTAATATAGG + Intergenic
1024656462 7:51454859-51454881 CAATATCAGCAGACACTAATGGG - Intergenic
1024758170 7:52561712-52561734 CAGTATCTACAGACACCTAGGGG + Intergenic
1027305163 7:76887178-76887200 CAGTGTGATCAGACACATTGGGG + Intergenic
1029587764 7:101486404-101486426 CAGCCTCAGCAGAGACATTGAGG + Intronic
1030811201 7:113974385-113974407 CAGTATCAGCATACAGTAAGAGG + Intronic
1031220471 7:118958555-118958577 CAGTATGAGCAGACAAGGAGGGG - Intergenic
1035643654 8:1201774-1201796 CAGCATCCGCAGACACACAGCGG + Intergenic
1035990465 8:4484405-4484427 CAGAACCAGAAGACACAGAGAGG + Intronic
1040964098 8:53066755-53066777 CAGTAACAACAAACACACAGGGG - Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042874306 8:73426736-73426758 CAGTATCAACAGAAACATTTCGG + Intronic
1043588458 8:81797171-81797193 CATTAGCAGCAGTCAAATAGTGG - Intergenic
1043625048 8:82245925-82245947 CAATTTTAGCAGACACAAAGAGG + Intergenic
1043959831 8:86404821-86404843 CAGAATCAACAGCCAGATAGCGG - Intronic
1045543992 8:103111939-103111961 CAGTTTCAGCAGAGACCCAGAGG + Intergenic
1046535835 8:115509064-115509086 CAGTATAAGGAGCCACAGAGAGG - Intronic
1048925714 8:139269358-139269380 CAGCATCTGCTGACACATACTGG + Intergenic
1057226195 9:93294535-93294557 CAGGGTCAGCAGGCACAAAGGGG + Intronic
1057426371 9:94953377-94953399 CAGAATCAGCAGATACCTAAAGG - Intronic
1059263097 9:112998150-112998172 CAGCATCAGAAAACACATATTGG - Intergenic
1062036072 9:134383138-134383160 CAGTGTCAGCACACACAGGGGGG + Intronic
1062710353 9:137971993-137972015 CAGAATCAGCAGCCACGTGGTGG - Intronic
1185869019 X:3648284-3648306 CTTTATTAACAGACACATAGGGG + Intronic
1190167221 X:48083243-48083265 CTGTATTAGCAGTCACATAGAGG + Intergenic
1190744261 X:53312126-53312148 CAGCATGAGCAAACACACAGAGG - Intronic
1196691717 X:118566058-118566080 CAGTTTCAGCAGCCAGATAATGG - Exonic
1197640076 X:128958150-128958172 CAGTATGAGCAAAGACATAGAGG - Intergenic
1198229121 X:134672994-134673016 CAGTTTAAGCAGACACAGAGGGG - Intronic
1201286804 Y:12385978-12386000 CATGATTAGCAGACAGATAGAGG + Intergenic