ID: 984655101

View in Genome Browser
Species Human (GRCh38)
Location 4:182309018-182309040
Sequence CTGTGGAGACAGTAGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984655101_984655106 6 Left 984655101 4:182309018-182309040 CCTAGCCCCTACTGTCTCCACAG 0: 1
1: 0
2: 2
3: 43
4: 354
Right 984655106 4:182309047-182309069 CAGAGACTTTCCTCAGTTCTTGG 0: 1
1: 0
2: 1
3: 28
4: 308
984655101_984655107 7 Left 984655101 4:182309018-182309040 CCTAGCCCCTACTGTCTCCACAG 0: 1
1: 0
2: 2
3: 43
4: 354
Right 984655107 4:182309048-182309070 AGAGACTTTCCTCAGTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984655101 Original CRISPR CTGTGGAGACAGTAGGGGCT AGG (reversed) Intronic
900880969 1:5381099-5381121 CTGTGGAGACTGCAGGGGGCTGG - Intergenic
900947856 1:5841288-5841310 CTGTGGGGACCGTGGGGGCAGGG - Intergenic
901277590 1:8004785-8004807 CTGTGAAGATAGCACGGGCTGGG - Intronic
901768610 1:11519332-11519354 CTGTGGAGAGAGTAGGGGACAGG - Intronic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902775881 1:18674651-18674673 CTTTGGAGCCACGAGGGGCTAGG + Intronic
903008874 1:20316593-20316615 CTGTGGAGACAGAACAGGATGGG + Intronic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903410560 1:23140039-23140061 CCTTGGAGAGAGTAAGGGCTGGG + Intronic
904075515 1:27839023-27839045 CTGTGGAGAGAAGAGGGGTTTGG + Intronic
904261525 1:29290424-29290446 CTGTGGAGTCAGCAGGGGCCTGG - Intronic
904292912 1:29499156-29499178 CTGTGGAGTCAGCAGGGGCCTGG + Intergenic
904334035 1:29785467-29785489 CTGTGGAGTCAGCAGAGGCCTGG + Intergenic
904412352 1:30332106-30332128 CTGTGGAGTCAGCAGGGGCCTGG - Intergenic
905404329 1:37722960-37722982 GTGTGGACAGAGTAGGGGCGGGG + Intronic
905866587 1:41380300-41380322 CTATGGAAACAGCAGGGGCTTGG - Intronic
906676077 1:47694466-47694488 CTGTGGGGGCTGCAGGGGCTGGG + Intergenic
906688849 1:47779598-47779620 CTCTGGACACAGGAGGTGCTGGG + Intronic
906698856 1:47843107-47843129 CAGTGGTGACAGTAGGGGTGGGG + Intronic
907485759 1:54777054-54777076 CTGTTCAGACAGCAGGGGCCAGG - Intergenic
908205517 1:61844222-61844244 CTGTGTGGACAGTAAGGGATTGG + Intronic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
911583943 1:99668481-99668503 CTAAGGTGAGAGTAGGGGCTGGG - Intronic
912575790 1:110672100-110672122 CTGTGGAAACGGCAGGGGCTGGG + Intergenic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
916207336 1:162328091-162328113 CTGTGGAAAGAGCATGGGCTTGG - Intronic
916243335 1:162661428-162661450 CTGGGCAGACTGTATGGGCTTGG + Intronic
917567762 1:176230210-176230232 CTGGGGAGTCAGTAGGTGTTGGG - Intergenic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920362582 1:205429593-205429615 CTGTGGAGATAGCCGGGGTTGGG + Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
921262710 1:213397922-213397944 CCGTGGAGACAGAAGGGCCTGGG + Intergenic
922391794 1:225151317-225151339 CTGTGGATATAGTTGGGGGTGGG + Intronic
923618490 1:235557528-235557550 ATGTGTAGACAGAAGGGGATTGG - Intronic
1062788363 10:284151-284173 CTGTGGAGACATTCTGGGCTTGG + Intronic
1063494018 10:6490210-6490232 CAGTGGAGGCAGGAGGGGTTAGG - Intronic
1064847185 10:19668265-19668287 CTGTGGTGACAGTGGGAGTTTGG - Intronic
1064950101 10:20839016-20839038 CTGTGGAGATACTATGGGTTCGG - Intronic
1066101660 10:32123116-32123138 CTGTGGAGCCCGTGGGAGCTGGG - Intergenic
1067409927 10:46055377-46055399 CTGTAAAGAGAGCAGGGGCTTGG - Intergenic
1068605009 10:58995556-58995578 CTCTGGAGACAGGAGGCTCTGGG + Intergenic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1070324362 10:75378284-75378306 CTGTGAAGCCAGTTGGGGATGGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071495912 10:86167520-86167542 CTGTGGGGACAGTGGTTGCTGGG + Intronic
1071565009 10:86667268-86667290 CTGAGGAGTCAGTAGAGGCCTGG - Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072761696 10:98062077-98062099 CTGTGGAGTCACTGGGGGCAGGG + Intergenic
1073001720 10:100290656-100290678 CTCTGGAGACAATAGGGTCAGGG + Intronic
1073546501 10:104353842-104353864 CTGTGGAGATCGCAGGAGCTGGG - Exonic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1076737742 10:132466259-132466281 CTGTGGCCACAGGAGGGGCCCGG - Intergenic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077429207 11:2507683-2507705 CTGGGGAGAGAGTGCGGGCTGGG + Intronic
1077602395 11:3582458-3582480 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
1078025908 11:7695455-7695477 ATGTGGAGTCAGTTGGGCCTTGG + Intronic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1079156678 11:17954442-17954464 CTGTGGAAAGTGTAGGGGCCTGG + Intronic
1080153035 11:29076247-29076269 CTGTGGCAACTGTAGGGGATGGG + Intergenic
1080210702 11:29781529-29781551 CTGTGGGGCCAGTAGTGGGTGGG + Intergenic
1080897116 11:36456033-36456055 CTGTGGAGAGAGCAGGGCCTTGG + Intronic
1081168276 11:39833991-39834013 CTGTGCATACATTAGTGGCTGGG + Intergenic
1081179495 11:39968594-39968616 GTGCCGAGAAAGTAGGGGCTTGG + Intergenic
1083882816 11:65556947-65556969 CTGGGGAGGGTGTAGGGGCTTGG + Intronic
1084258289 11:67957005-67957027 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
1084346090 11:68549923-68549945 CTGTGGAGACAGCAGGAGTCTGG + Intronic
1084364089 11:68686261-68686283 ATGTGGAGAAAGTAGAGGCCTGG - Intronic
1084673795 11:70622763-70622785 GATTGGAGACAGTAGGGGGTTGG - Intronic
1084814457 11:71638205-71638227 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
1085409037 11:76280925-76280947 CTGTGGAGAGATGAGGGCCTGGG + Intergenic
1085479024 11:76806426-76806448 CTGTGAAGACGGAAGAGGCTGGG + Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1088627220 11:111737908-111737930 CTCTGGAGACAGAAATGGCTTGG + Intronic
1089528538 11:119112382-119112404 CTGTGGAGACAGTAAGTGAGGGG + Exonic
1089778017 11:120852642-120852664 CTTTGAAGACAGTAGCAGCTGGG - Intronic
1089844158 11:121445456-121445478 CTGTGGGGACAGCAGAAGCTGGG - Intergenic
1089983887 11:122794909-122794931 CTTTGGAGACAGCAAGGGCAAGG - Intronic
1090082490 11:123623283-123623305 GTGTGGACCCAGTAAGGGCTGGG + Intronic
1090288282 11:125519221-125519243 ATGCTGAGAGAGTAGGGGCTTGG - Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090919311 11:131194150-131194172 CTGAGGAGACAGCAAAGGCTGGG - Intergenic
1091203508 11:133800934-133800956 GTGTGGGGGCAGTAGGGGATGGG - Intergenic
1091335809 11:134764844-134764866 CTGTGAAGACCTGAGGGGCTTGG + Intergenic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1093630894 12:21407851-21407873 CTGTGGAGACAGGACTGGCCAGG + Intronic
1093718105 12:22406932-22406954 CTAAGGAGACAGTAGCTGCTGGG + Intronic
1095279786 12:40336510-40336532 CTGTGTTGACAGTAGGGGAAGGG + Intronic
1096519738 12:52178180-52178202 CGATGGAGGCAGTAGGGGCCAGG - Intronic
1098703962 12:73664543-73664565 CTGTGGAGTCACTGGGGGCCAGG - Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1103282428 12:119771122-119771144 CTTTGCAGATAGTAGGTGCTTGG - Intronic
1103505330 12:121439211-121439233 GTGTTGAGACAGTGGGGGCCGGG - Intronic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1104921227 12:132291793-132291815 GTGTGGGGACAGGAGGGGATGGG - Intronic
1105872417 13:24517177-24517199 CTGTGCAGACAGTGTGGGCACGG - Intergenic
1106660943 13:31799190-31799212 GTGTGGAGACAGTAGTGGGGAGG - Intronic
1107961752 13:45565218-45565240 CTGTGGACTCAGTAGAGGCATGG - Intronic
1108477138 13:50831466-50831488 GTGTGGAGTCAGAAGGGGCTGGG + Intronic
1108854544 13:54776013-54776035 CTGTGGAGTCCGTGGGAGCTGGG - Intergenic
1112569262 13:100579311-100579333 CTGTGGGGAGAGGAGGGCCTAGG + Intronic
1112899174 13:104338389-104338411 CTGTGGAGTAAGGTGGGGCTGGG - Intergenic
1113229188 13:108194502-108194524 CTGTGGAGCCAGCAGGGGCCGGG + Intergenic
1113528544 13:111001821-111001843 CTGTGGAGACCATAGGGACATGG + Intergenic
1113637461 13:111929443-111929465 CTGCGGAGGTAGCAGGGGCTGGG - Intergenic
1113814154 13:113159901-113159923 CTGTGGAGACGGACGGGGCTGGG + Intronic
1114734721 14:25032584-25032606 CTGTGGTGACAGTTGGCTCTTGG - Intronic
1116019175 14:39440930-39440952 CTGTGGAGCCCGTAGGGGGTGGG + Intergenic
1116502767 14:45640248-45640270 CTGTGAAGAATGTAGGGGTTAGG - Intergenic
1116657654 14:47673174-47673196 CAGTGGACACAGTAAAGGCTGGG + Intronic
1117339812 14:54783546-54783568 CTCTGCAGGCAGTAGGGGCTCGG - Intronic
1117831398 14:59754870-59754892 CTGTGAAGACAGCATGGCCTTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120595732 14:86432973-86432995 CTGAGGAGGAAGAAGGGGCTAGG + Intergenic
1122603690 14:102933761-102933783 CTGTGGGGGGAGTTGGGGCTCGG + Exonic
1122871557 14:104641187-104641209 CAGTGGGGACGGTGGGGGCTGGG - Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1126115744 15:45206053-45206075 CTATGGAGAAAGTAGGTGATAGG + Intergenic
1127304152 15:57685646-57685668 AAGTGGAGACAGTAAGGGGTGGG - Intronic
1127370127 15:58331404-58331426 CTAGGGAGACAGTAGGAGCCGGG - Intronic
1127398560 15:58563176-58563198 CTGTGGAGACAGTGGGGCTTTGG - Intronic
1128103495 15:65025757-65025779 CTGTGGAGGCAGTAGGTATTAGG + Intronic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1128744727 15:70105571-70105593 CTTTGGAGACAGAGGGGCCTGGG - Intergenic
1129258398 15:74347830-74347852 CTGTGGAGAGGGCAGAGGCTGGG - Intronic
1129329005 15:74817132-74817154 CTGAGGAGGCAGTAGGGCCGGGG - Intronic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129677771 15:77641710-77641732 CTGTGGAGTCAGGTGGTGCTGGG + Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130678217 15:85973300-85973322 CTGAGGAGGGAGTAGGGGTTAGG - Intergenic
1133369681 16:5238556-5238578 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
1133606676 16:7394375-7394397 CTAAGGAGACAGAAGGGACTGGG - Intronic
1133860737 16:9592575-9592597 CTATGGTGACAGAAGGGGATGGG + Intergenic
1134903484 16:17959619-17959641 CTCAGGAGACAGAAGAGGCTAGG + Intergenic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1136230875 16:28884552-28884574 CTGTGGAGAGAGTAGGGAAGAGG - Intronic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1138184060 16:54962997-54963019 CAGTGGAGACAGTAAGGCCGGGG + Intergenic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1140822829 16:78679103-78679125 CTGTGGAGACACCAGCGTCTTGG + Intronic
1141162178 16:81636791-81636813 CTTTGGAGACGGAAGTGGCTCGG - Intronic
1141167499 16:81670119-81670141 CTGTGGAGACAGCAGAGGACAGG - Intronic
1143054470 17:4152482-4152504 CTGTGGATACAGGATTGGCTTGG + Intronic
1143895716 17:10134785-10134807 CTGGGCAGACAGTAGAAGCTCGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144255713 17:13465076-13465098 CGGTGGAGACATTAGGAGGTGGG + Intergenic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1146803220 17:35844175-35844197 CTTTGGTGAGAGTAGGGGTTGGG + Intronic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147864835 17:43545495-43545517 CTGTGGTGAGAGTAGGGGCTGGG + Intronic
1148977930 17:51545867-51545889 CTTTGCACATAGTAGGGGCTTGG + Intergenic
1149285579 17:55160623-55160645 CCGTGGAGACAGCAGGGTATGGG - Exonic
1151263079 17:72931944-72931966 CTGTGGTGAGAGCAGGGCCTGGG - Intronic
1151955369 17:77377569-77377591 CTCGGGCGACAGTGGGGGCTCGG - Intronic
1152382207 17:79947840-79947862 CGGTGGAGACAGCAGTGGGTGGG + Intronic
1152694138 17:81735313-81735335 CTCTGGGGACCGCAGGGGCTGGG - Intergenic
1153619721 18:6966105-6966127 GTGTGTATACAGTAGGGCCTAGG + Intronic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1154348834 18:13566196-13566218 CTGGGGAGATAGTAGGGGAAAGG + Intronic
1155726260 18:29088015-29088037 CTGTGACGACAGAAGTGGCTAGG + Intergenic
1157589622 18:48828703-48828725 CTGTGGGGAGAGAAAGGGCTGGG - Intronic
1158774000 18:60555196-60555218 CTGTGGAGCCAGAAGGAGCTGGG + Intergenic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161057057 19:2195942-2195964 CTGAGGAGACAGTGAGGGGTGGG - Intronic
1161321121 19:3641989-3642011 CTGTGGTGCCAGCAGGGCCTGGG + Intronic
1161454543 19:4363474-4363496 CTGTGGGGACAGTAGGGCTCAGG + Intronic
1161934414 19:7362758-7362780 CTGTGGAGAAAGGAGGGACAAGG - Intronic
1163150944 19:15413678-15413700 CAGTGGAGACCGCAGGGGCTGGG - Intronic
1163463733 19:17454742-17454764 CTCTGGGGGCAGGAGGGGCTGGG - Intronic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1165048743 19:33127591-33127613 CTGTGGAGAAAGTAGAGGTTTGG - Intronic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165120290 19:33554359-33554381 CTGTGCAGTCAGGAGGGCCTGGG - Intergenic
1165386529 19:35513481-35513503 CTCTGGAGAGAGAGGGGGCTGGG - Exonic
1165744888 19:38224662-38224684 CTCTGGAGCCAGGAGGGACTTGG - Intronic
1165778282 19:38417717-38417739 CTGTGGAGAGAGTGGGGCCAGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166089270 19:40497735-40497757 CTGAGGAGACAGTTGGGATTTGG - Intronic
1166799373 19:45446697-45446719 CGGTGTAGAAAGTAGGAGCTGGG + Intronic
1166837232 19:45674902-45674924 CTGTGGAGAGTGTAGGAGATAGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167560782 19:50225768-50225790 CTGTTGAGGGAGGAGGGGCTGGG + Intronic
1168710453 19:58497171-58497193 CATTGGAGTCAGTAGGGGTTTGG - Intronic
926084003 2:10009866-10009888 CTGTTGGGACAGCAAGGGCTGGG + Intergenic
926302769 2:11616451-11616473 CTGAGGAGACAGGAGGGAGTGGG - Intronic
928255993 2:29723127-29723149 CTGTGGGGCCTTTAGGGGCTAGG - Intronic
928589923 2:32803519-32803541 CTGGGGAGACAGAAGTGGGTTGG - Intronic
929147866 2:38722296-38722318 CTGTGGAGGGTGTAGGGGGTGGG - Intronic
931489181 2:62725695-62725717 CTTTGGAGGCAGCAGTGGCTGGG + Intronic
932408007 2:71526773-71526795 CTGTGAAGACAGTGGGGCCCAGG - Intronic
932806085 2:74784688-74784710 CTGTGGACACAGCAGGTTCTGGG + Intergenic
933902865 2:86861900-86861922 CGGCGGAGACAGTCGCGGCTGGG + Exonic
933976751 2:87518298-87518320 CTGCGCAGAAAGTAGAGGCTTGG + Intergenic
935777680 2:106487370-106487392 CGGCGGAGACAGTCGCGGCTGGG - Intergenic
937294059 2:120799172-120799194 CTGTGGCGGGAGTAGGGGCCAGG + Intronic
937923003 2:127145629-127145651 CTGTGGGGCCAAGAGGGGCTGGG + Intergenic
938298615 2:130194304-130194326 CTGTGGAGACCTGGGGGGCTGGG + Exonic
938458116 2:131480209-131480231 CTGTGGAGACCTGGGGGGCTGGG - Exonic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939737215 2:145862604-145862626 CTATGGTGACAGTAGCTGCTGGG - Intergenic
940925864 2:159363049-159363071 CTGTAGGGATAGTAGAGGCTTGG + Intronic
944731451 2:202521697-202521719 CTGTGGGGACAGTATGAGCCTGG + Intronic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
946999528 2:225437815-225437837 CTATGGAGTCAGATGGGGCTAGG - Intronic
948139289 2:235660945-235660967 CTGTGGAGACTGGAGGGTGTCGG + Intronic
948601612 2:239110902-239110924 CTGAGGAGGCAGGAGGGGCCGGG - Intronic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
949024087 2:241757030-241757052 CTGTGGTTACAGGAGGGTCTAGG + Intronic
949075277 2:242053377-242053399 CTGTGAAGACAGGAGGTGTTTGG + Intergenic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172772159 20:37388166-37388188 CTGTGGAGGCAGGAAGGGCTGGG + Intronic
1173654455 20:44690150-44690172 CTGTGGAGATAGTAAGGGGAGGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175305042 20:57970076-57970098 CTGTGGAGAGAGCAGTGGATGGG + Intergenic
1175362779 20:58426729-58426751 TTGTGGAGTTTGTAGGGGCTAGG + Intronic
1178717593 21:34980403-34980425 CTGTGAAGATAGGAGGAGCTGGG + Intronic
1178721981 21:35018346-35018368 CTTTTGAGATACTAGGGGCTGGG - Intronic
1179285149 21:39971079-39971101 CTGTGGAGTCAGTCAGAGCTGGG - Intergenic
1179468894 21:41597515-41597537 CTGTGGAGCAAGCAGGGACTAGG + Intergenic
1179561959 21:42221059-42221081 ACGTGGAGACAGTAACGGCTGGG + Intronic
1180089802 21:45528075-45528097 CAGTGGGGACAGTGGAGGCTCGG + Intronic
1180115812 21:45704248-45704270 GTGTGGAGTCAGTGGTGGCTGGG + Intronic
1180181664 21:46120968-46120990 CTGTGGACACTGCAGGGCCTCGG - Intronic
1180633123 22:17243711-17243733 GTGTGGAGAAAGTGGGGGGTAGG - Intergenic
1181084601 22:20433745-20433767 GGGTGGAGACAGTGGGGGCAGGG - Intronic
1181510414 22:23386438-23386460 CTGGGGAGACAGTGGAGCCTGGG - Intergenic
1183483633 22:38077949-38077971 GTGTAGAGACACAAGGGGCTGGG - Intergenic
1183691599 22:39392765-39392787 GTGTGGGGACAGTGGGGGCCAGG - Intergenic
1184003675 22:41693623-41693645 CTGTGGAGAGAGCAGGTTCTGGG - Exonic
1184517090 22:44969317-44969339 CTGTGGAGTCAGGAGGGTGTGGG + Intronic
951558176 3:23942307-23942329 TTGTGGAGGCAGGAGGTGCTTGG - Intronic
951566991 3:24020465-24020487 CTGTGGAGCCAGTGGGGGCCAGG - Intergenic
952466798 3:33597657-33597679 CTGGGGGGCCAGTAGGGGATTGG - Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
954302008 3:49705172-49705194 CCGTGAGGACAGTAGGTGCTTGG + Exonic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954631405 3:52049644-52049666 CTGGGGAGACATTAGGTGGTGGG - Exonic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
954882097 3:53843466-53843488 CTGTGCAGACCCTAGGGTCTGGG + Intronic
954965426 3:54606340-54606362 CTGGGGAGCAAGTCGGGGCTGGG + Intronic
955121256 3:56060823-56060845 CTTTGGGGGCAGTAGGGGCAGGG - Intronic
955655272 3:61239040-61239062 CTGTGGAGATAGTAGGCATTAGG + Intronic
957073245 3:75581524-75581546 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
957459505 3:80497947-80497969 CTGTGGAGCCCATGGGGGCTGGG - Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG + Intergenic
958161338 3:89819232-89819254 CTGTGGAGTCAGAGGGGGCCTGG - Intergenic
960417704 3:117405486-117405508 CTGAGGAGGCAGCAGGGGCATGG + Intergenic
961167030 3:124770403-124770425 CTGTGGGGACCAAAGGGGCTGGG + Intronic
961280837 3:125765254-125765276 CAGTGGAGGCAGTAGAGGCTGGG - Intergenic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
961564492 3:127754006-127754028 CTGTGGCTACAGAATGGGCTAGG - Intronic
961822403 3:129581913-129581935 TTGTGTACACAGCAGGGGCTCGG - Intronic
961828960 3:129613484-129613506 CTTTGCTGACAGCAGGGGCTGGG + Intergenic
961829823 3:129617743-129617765 CTGTGGAGCCAGAAGGATCTGGG + Intergenic
961873553 3:130004330-130004352 CAGTGGAGGCAGGAGAGGCTGGG + Intergenic
968459780 4:718774-718796 TTGTGGCCACGGTAGGGGCTGGG + Intronic
968661322 4:1799947-1799969 CTCAGGATACAGGAGGGGCTGGG + Intronic
969737119 4:8999496-8999518 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
969796311 4:9531084-9531106 CAGTGGAGGCAGGAGAGGCTGGG - Intergenic
970135115 4:12913551-12913573 CACTGTAGGCAGTAGGGGCTTGG - Intergenic
970500416 4:16671479-16671501 CTGCTGAGACAGTAGGGACCTGG - Intronic
970529107 4:16964232-16964254 CTTTTGAGACACTAGGGGTTAGG - Intergenic
972094142 4:35327411-35327433 CTGGTAAGAAAGTAGGGGCTGGG + Intergenic
975044310 4:69783258-69783280 CCGTGGAGCCAGTAGGAGCTGGG + Intronic
976041269 4:80887391-80887413 CAGTGGAAACATTAGGGGCCAGG + Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978249162 4:106610137-106610159 CCATGGAGCCAGTAGGGGCTGGG + Intergenic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
978310141 4:107378655-107378677 ATGGGGAGACAGTAGGGGGATGG + Intergenic
980484869 4:133443293-133443315 CTGTGGAGAAATTAGGGACTAGG + Intergenic
982027279 4:151263380-151263402 CTGAGGAAAAAGTAGGGACTTGG + Intronic
982802724 4:159723595-159723617 CCGTGGAGCCAGCAGGGGCCAGG - Intergenic
983323683 4:166227054-166227076 CTGTGGAACCAGTGGGAGCTGGG + Intergenic
984245813 4:177274490-177274512 CTGTGGAGAAAGGAAGAGCTGGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984763648 4:183383597-183383619 CTGTGGAGCCACCAGGAGCTAGG + Intergenic
985505672 5:278860-278882 CTGGGGACACGGGAGGGGCTGGG + Intronic
985606728 5:861969-861991 CGGTGGAGGGAGCAGGGGCTGGG - Intronic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
986831620 5:11585844-11585866 GTGAGGAGAAAGGAGGGGCTAGG + Intronic
988238419 5:28575939-28575961 CTGTGGAGAAAGGGAGGGCTAGG - Intergenic
989260267 5:39411774-39411796 CTGTGGAGAATGGAAGGGCTTGG - Intronic
991039789 5:62163107-62163129 CTATGGAGCCAGCAGGGGCTAGG - Intergenic
993618166 5:90137423-90137445 CCATGGAGCCAGTGGGGGCTGGG - Intergenic
994753310 5:103764714-103764736 CTTTGGAGACCGTTGGGGCAGGG + Intergenic
995145908 5:108787020-108787042 CTGCAGAGCCAGCAGGGGCTGGG + Intronic
996010753 5:118479162-118479184 CTGTGGCTGCTGTAGGGGCTGGG - Intergenic
996117578 5:119634782-119634804 CTGGGGAGACAGTACTGGCTCGG - Intronic
996176637 5:120368043-120368065 CTATGGAGACAGTGGGGACCAGG + Intergenic
996442914 5:123512282-123512304 CGGTGGCGACAGCAGAGGCTCGG + Intronic
996722953 5:126647852-126647874 CTGGGAAGAAAGTAGGAGCTAGG + Intergenic
998406651 5:141878185-141878207 CGGTGGAGGCAGCAGCGGCTTGG - Intronic
999008666 5:148010167-148010189 CTTTGGAGACAGAAGAGTCTGGG + Intergenic
999254707 5:150203884-150203906 CTGAGGAGAGAGGAGGGGCTGGG - Intronic
1000303465 5:159975331-159975353 ATTTGGAGTCAGTAGGGCCTTGG + Intergenic
1000422667 5:161056240-161056262 ATGAGGAGACAGAAGTGGCTGGG + Intergenic
1001164477 5:169351087-169351109 CTGGGGAGCCAGTAGGAGCGAGG + Intergenic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1001301985 5:170540257-170540279 CTGTAGAGACAGCAGCTGCTAGG + Intronic
1001403521 5:171460518-171460540 CTCTAGAGACAGAAGGGCCTGGG - Intergenic
1001941237 5:175741156-175741178 CTCTGGAGACAGAGGGGTCTGGG - Intergenic
1002171690 5:177378277-177378299 CTGTGAAAACTGTAGGGTCTGGG + Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1006021852 6:31121996-31122018 CTGTGGAGAGAGGAAGGGATAGG + Intronic
1006172114 6:32099178-32099200 CTTAGAAGACAGTAGGAGCTGGG - Intronic
1006374673 6:33665310-33665332 CTGGGGAGAGAGTAGGGGACTGG + Intronic
1006933883 6:37704225-37704247 CAGTGGAGTCAGATGGGGCTGGG - Intergenic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1007357355 6:41331482-41331504 CTTCGGAGAGAGTAAGGGCTGGG + Intergenic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1011112186 6:83850954-83850976 CTGTAGAGATAGAAGGGGTTTGG - Intergenic
1011168627 6:84479468-84479490 CTGTGGATGCTGTGGGGGCTGGG - Intergenic
1013040440 6:106427617-106427639 CGGTGGAGACAGTAGGGCAGCGG - Intergenic
1016013282 6:139160061-139160083 CTGGGGAGACAGGATAGGCTTGG + Intronic
1016405406 6:143724591-143724613 CTGTGTAGAAACTCGGGGCTGGG - Intronic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1019504492 7:1383988-1384010 CCGTGGAGGCAGCAGGGACTGGG - Intergenic
1019667493 7:2259139-2259161 CTCTGGAGACAGCAGGGGTCTGG + Intronic
1019716013 7:2539720-2539742 GGGTGGAGGCAGCAGGGGCTGGG - Intronic
1019777110 7:2918450-2918472 CTGTGGGGGCAGCAGGGGCAGGG - Intronic
1020202575 7:6091755-6091777 TTTTGGAGACAGTGGGGGATGGG + Intergenic
1021960786 7:25871137-25871159 CTGTGGGGACATGAGGGCCTGGG + Intergenic
1022742614 7:33137444-33137466 CTGCGGAGCCAGTGGGGGCTGGG - Intronic
1023418378 7:39951716-39951738 CGGCGGCGACTGTAGGGGCTCGG - Exonic
1023562634 7:41491658-41491680 CTGGGGAGACAGCAGTGGGTAGG - Intergenic
1024301029 7:47887830-47887852 CTGTAGAGGCAAGAGGGGCTGGG + Intronic
1026914501 7:74111864-74111886 CTGGGGAGCCAGGATGGGCTGGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1034446806 7:151117868-151117890 CTGGGAAAAGAGTAGGGGCTTGG - Intronic
1035080284 7:156210087-156210109 CCGGAGAGACAGTAGGTGCTTGG + Intergenic
1035362914 7:158325165-158325187 CTGTGGAGATTGTGGGGCCTGGG - Intronic
1035394426 7:158526011-158526033 CAGAGGGGAGAGTAGGGGCTGGG - Intronic
1036679924 8:10864491-10864513 CTGTTGAGGCAGTAGGGGAGTGG + Intergenic
1037507044 8:19540952-19540974 CTGGGGACAGGGTAGGGGCTTGG - Intronic
1037678113 8:21069669-21069691 CTGTGTAGACGATAGGGGCTTGG + Intergenic
1037915797 8:22772729-22772751 TAGAGGAGACAGTAGGGCCTGGG - Intronic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041080177 8:54208245-54208267 CTGGAGAGGCAGTAGGGGTTAGG + Intergenic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1044391998 8:91662595-91662617 CACTGGAGTCAGTAGGGGTTTGG - Intergenic
1044823380 8:96174071-96174093 CTGTGAAGAAAGAAGGGGGTAGG - Intergenic
1044892935 8:96856308-96856330 CTGTGGAGACAGTGGGCAGTGGG + Intronic
1045907650 8:107367140-107367162 CTTTGGAGACATTATGGGTTTGG + Intronic
1047171447 8:122497111-122497133 CTGTGGGGAAGGTTGGGGCTGGG - Intergenic
1047717703 8:127610967-127610989 AGGAGAAGACAGTAGGGGCTGGG - Intergenic
1049226026 8:141450882-141450904 CTTTGGAGTCAGAAGGGTCTAGG + Intergenic
1049432620 8:142572278-142572300 GTGTGGGGCCAGGAGGGGCTTGG - Intergenic
1049538325 8:143193429-143193451 CTGTGGAGGCAGAAGGACCTGGG + Intergenic
1051150666 9:14075421-14075443 CTGAGGAGAAAGGAGGGGTTTGG - Intergenic
1051793996 9:20843434-20843456 CTGTGGAAACATTACAGGCTAGG - Intronic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1053421154 9:37979485-37979507 ATGTGGAGAAGGTAAGGGCTGGG + Intronic
1055324903 9:75119021-75119043 CTTTGGGGACAGCAGGGTCTGGG - Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1057447847 9:95130700-95130722 CTGTGGAGAGAACAGTGGCTCGG - Intronic
1058938291 9:109789644-109789666 ACGTGGAGACTGTAGGGGATGGG + Intronic
1059053298 9:110952478-110952500 ATGTGGAGAGAGGAGGGTCTTGG - Intronic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1060179996 9:121527427-121527449 CCATGGAGCCAGTGGGGGCTGGG + Intergenic
1060792708 9:126496968-126496990 TGGAGGAGACAGGAGGGGCTGGG + Intronic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062039681 9:134398538-134398560 CTGTGTAAACAGGAAGGGCTGGG + Intronic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062192308 9:135254321-135254343 CAGTGGAGGCAGCAGGTGCTGGG - Intergenic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1062234965 9:135503416-135503438 CTGTGGGGGCACTATGGGCTGGG - Intronic
1186230155 X:7445077-7445099 CTGTGGTGACAGAAGGGGAAGGG - Intergenic
1189023756 X:37370447-37370469 CCATGGAGCCAGCAGGGGCTGGG + Intronic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1189920746 X:45901020-45901042 CTGTGGAGCCATGATGGGCTGGG - Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1191026518 X:55919693-55919715 CTGTGGCTGCTGTAGGGGCTGGG - Intergenic
1192146292 X:68685143-68685165 GTATGGAGACAGTAGGGGGGAGG + Intronic
1192630385 X:72773263-72773285 CTGTGGACAGAGTAGTGGATTGG + Intergenic
1192651325 X:72947541-72947563 CTGTGGACAGAGTAGTGGATTGG - Intergenic
1192713816 X:73618446-73618468 CTGTGGCTGCCGTAGGGGCTGGG + Intronic
1195107803 X:101617386-101617408 GTGTGGAGAAAGAAGGGGCCAGG + Intronic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199938578 X:152601788-152601810 TGGTGGAGTCAGTAGGGGATCGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200133357 X:153863185-153863207 CTGTGTGGAGAGGAGGGGCTGGG + Intronic
1201956734 Y:19632951-19632973 CTGTGAAGACCGTCGAGGCTAGG - Intergenic