ID: 984656505

View in Genome Browser
Species Human (GRCh38)
Location 4:182324423-182324445
Sequence GGCACCAATGTGCCCACCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984656505_984656512 1 Left 984656505 4:182324423-182324445 CCACCGGTGGGCACATTGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 984656512 4:182324447-182324469 CAGGCACAGGCACTGACACGTGG 0: 1
1: 0
2: 2
3: 32
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984656505 Original CRISPR GGCACCAATGTGCCCACCGG TGG (reversed) Intronic
900456840 1:2779166-2779188 GGCACCCAGGTGTCCACCGATGG - Intronic
900913832 1:5620607-5620629 GGGACCACTGTCCCCACCAGGGG - Intergenic
901442523 1:9287131-9287153 GGCACCAGATGGCCCACCGGTGG - Intergenic
902837037 1:19054041-19054063 GGCACCAAACTGCCCCCCGCAGG - Intergenic
903189844 1:21650466-21650488 GGCACCAAGGTGCCCTCAGAGGG - Intronic
904560595 1:31394791-31394813 CGCACCAGTTTGTCCACCGGGGG + Intergenic
908496425 1:64699485-64699507 TGCAGCAATGTGGCCACAGGAGG - Intergenic
1062842558 10:682210-682232 GGCCCCAGTGTGCCCAGCGCAGG - Intronic
1064072709 10:12244560-12244582 GTCACCAAATTGCCCACCTGTGG + Intronic
1067660881 10:48235519-48235541 AGCACCAATGAGCCCACCTCTGG - Intronic
1070129075 10:73644323-73644345 GGCACAAATGTGCCCTCTGCTGG + Intergenic
1076921053 10:133454845-133454867 GGCAGCAATGTGGCCACAGATGG + Intergenic
1078088313 11:8247934-8247956 GGCAGCACTGTGCCCACCCGAGG - Intronic
1084566104 11:69930080-69930102 GGCCCCAGTGTGCCCACTGAGGG + Intergenic
1089635263 11:119807845-119807867 GGCACCAGTTTCCCCACCTGTGG + Intergenic
1091694486 12:2618586-2618608 GACACCAATGTGGCCACCTGAGG + Intronic
1104048541 12:125181254-125181276 GGCACCACAGTGCCCACTGATGG - Intergenic
1104174744 12:126319405-126319427 GGCATCAATGAGTCCACCTGTGG - Intergenic
1112771573 13:102799584-102799606 GGCGCCCAGGTGCCCAGCGGAGG - Intronic
1114032503 14:18588921-18588943 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1114077285 14:19167947-19167969 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1114084880 14:19231617-19231639 GGTGCCTAGGTGCCCACCGGGGG + Intergenic
1119897434 14:78232039-78232061 GGCAGCAATGTGCCCACAAAAGG - Intergenic
1122461418 14:101898675-101898697 GGCCCCGATGTTCCCACCCGGGG + Intronic
1126037807 15:44563773-44563795 TGCACCACTGTGCCCACCTTAGG + Intronic
1128603187 15:69015182-69015204 GGGAACAATGTGCTCACCAGAGG - Intronic
1131036646 15:89226889-89226911 GGCACTATTGTTCCCACCAGGGG - Intergenic
1132660128 16:1057633-1057655 GGGCCCACTGTGCCCACCAGAGG + Intergenic
1136231566 16:28888686-28888708 TGCACCAACGTGCCCAGCTGGGG + Intronic
1142115150 16:88352623-88352645 GGTACCAAAGTGCCCACCATCGG - Intergenic
1144714595 17:17425139-17425161 GGCACCACTGTGTCCCCTGGCGG + Intergenic
1147450568 17:40501541-40501563 GGCAACAGTCTGCCCACCTGTGG - Exonic
1150272727 17:63876901-63876923 GGCACCCCTGTGCCCACCTGTGG - Intronic
1150274065 17:63884647-63884669 GCCACCCCTGTGCCCACCTGCGG - Intergenic
1150276223 17:63899452-63899474 GCCACCCGTGTGCCCACCTGCGG - Intergenic
1150278378 17:63914181-63914203 GCCACCCCTGTGCCCACCTGCGG - Intronic
1152560405 17:81075785-81075807 GGCCCCAATGTGCCCACGGAGGG - Intronic
1158381220 18:56932263-56932285 GGCATCAGTGTGCGCACCTGAGG - Intronic
1161218779 19:3108194-3108216 GGCAGCACTGTGGCCACCGTGGG + Intronic
1164768304 19:30788512-30788534 GGGACCCATGTGCCCAGCTGAGG + Intergenic
929080329 2:38116222-38116244 AGCAGCAATTTGCCCACCAGAGG + Intergenic
931944044 2:67285329-67285351 GGAACCACTGTGCCCACAGTGGG - Intergenic
933224204 2:79726599-79726621 GGCAACAATTTTTCCACCGGGGG - Intronic
933818778 2:86090797-86090819 GGCACCACTGTGCCCAGCTTAGG - Intronic
936507553 2:113119534-113119556 GGGACCATTGTACCCACTGGGGG - Intronic
947152844 2:227132183-227132205 GGCACCAAATTGTCCACCTGGGG + Intronic
948051435 2:234982271-234982293 GGCACCAGTGGGCACACCTGTGG + Intronic
948540715 2:238689951-238689973 AGCACCATTGAGCCCACCTGTGG - Intergenic
949053219 2:241908936-241908958 GGCACCAATGGTGCCACCGTAGG - Intergenic
1171986867 20:31666682-31666704 GTCACCAACCTGCCCACCAGAGG - Intronic
1173088661 20:39949640-39949662 GGCATCAATGTGCAAACCTGGGG + Intergenic
1175946163 20:62559750-62559772 GGCATCCATGTGGCCACCGCAGG - Intronic
1176023646 20:62975029-62975051 GGCACCTTTGTGCCCATCGTGGG + Intergenic
1176708991 21:10134313-10134335 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1176918950 21:14663387-14663409 GGCACCAGTGTGCTCACCCTGGG + Intergenic
1180293090 22:10861576-10861598 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1180456614 22:15515978-15516000 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1180495895 22:15890998-15891020 GGTGCCTAGGTGCCCACCGGGGG - Intergenic
1181179284 22:21055657-21055679 GGGACCACTGTGCCCACAGCAGG + Intronic
1182047719 22:27288809-27288831 GGTTCCAATGTGCACACGGGTGG - Intergenic
1184079721 22:42210792-42210814 GGGGCCAATATGCCCACTGGAGG + Exonic
1184378212 22:44128440-44128462 GACATCACTGTGCCCACTGGCGG - Intronic
950052004 3:9998894-9998916 GGCACCATGGTGCGCACCTGTGG - Intronic
958840047 3:99192298-99192320 GGTACCACTGTACCCACCTGGGG + Intergenic
960946644 3:122971404-122971426 GGCACTAATGTGCCCACTCATGG + Intronic
969604607 4:8196299-8196321 GGCACGAATGTGACCCTCGGTGG + Intronic
971117923 4:23669359-23669381 GACAGCAATGTGCCCACCAGAGG - Intergenic
978800734 4:112753122-112753144 GGCACCAATGTGCTCTCTGAAGG - Intergenic
979203341 4:118005502-118005524 GGCACCAATCTTCCCTCCTGAGG + Intergenic
981756444 4:148145618-148145640 GGCCCCACTGTTCCCAGCGGGGG - Intronic
984656505 4:182324423-182324445 GGCACCAATGTGCCCACCGGTGG - Intronic
984683050 4:182633216-182633238 GCCACCACTGTGCCCAGCCGAGG + Intronic
986595734 5:9420004-9420026 GGAACCAATATGGCCACCGAGGG - Intronic
990308707 5:54518184-54518206 TACGCCAATGTGCCCCCCGGGGG + Exonic
998407709 5:141883301-141883323 GGCGCCATTGTCCCCAGCGGGGG + Intergenic
999187466 5:149723059-149723081 GGCATCAATGTGCTCCCCTGGGG + Intergenic
1001384623 5:171328624-171328646 GCCACCTAAGTGTCCACCGGTGG + Intergenic
1004265635 6:14146217-14146239 GGCACCAGTGTGCCCACATCTGG + Intergenic
1017959733 6:159211061-159211083 GACACCAATCTGCACGCCGGGGG - Intronic
1023785299 7:43701512-43701534 GGCACCCAGGTGCCCATCAGTGG - Intronic
1023975709 7:45028282-45028304 GGCACCTTAGTGCCCACAGGAGG - Intronic
1028909080 7:96187798-96187820 GGCAGCGCTGTGCCCACAGGTGG + Intronic
1030963193 7:115953023-115953045 GACACCGATGTGCTCACTGGGGG + Intronic
1038680618 8:29663860-29663882 GGCACCAGGGTGCCCACCATGGG - Intergenic
1040821585 8:51564529-51564551 GGCACCAGTGTGCCTACTTGAGG - Intronic
1050712925 9:8486262-8486284 GGTCCAAATGTGTCCACCGGAGG + Exonic
1057908926 9:99003516-99003538 GCCAGCAGTGTGCCCACCGGGGG + Exonic
1197623541 X:128779028-128779050 GGTACCAACGTGCCCACAGTAGG - Intergenic
1199699378 X:150364618-150364640 GGCACCACGGTGCCCCCCGGGGG + Intronic
1201149550 Y:11088148-11088170 GGTGCCTAGGTGCCCACCGGGGG + Intergenic