ID: 984657195

View in Genome Browser
Species Human (GRCh38)
Location 4:182330928-182330950
Sequence TCTCATCTGAAGAGGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984657191_984657195 24 Left 984657191 4:182330881-182330903 CCAGCAGTTGGAGGAAAGTAGAA 0: 1
1: 0
2: 2
3: 27
4: 239
Right 984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG 0: 1
1: 0
2: 0
3: 37
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984657195 Original CRISPR TCTCATCTGAAGAGGGAGAG TGG Intronic
900078122 1:834402-834424 TGTCATCTAAAGGGCGAGAGTGG + Intergenic
907573234 1:55503352-55503374 TTTCAACTGCTGAGGGAGAGGGG + Intergenic
907907543 1:58797960-58797982 TCTCATCTGAAAAGTGAATGTGG + Intergenic
908061468 1:60354562-60354584 TCTCATCTATAGAGTGAGAGTGG + Intergenic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
909638865 1:77849685-77849707 TATAACCTGAAAAGGGAGAGAGG + Intronic
912238686 1:107881594-107881616 GCCCTTCTGAAGAGGGAGAGAGG - Intronic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
913501803 1:119478589-119478611 TGTGATATGAAGAGGGAGTGGGG + Intergenic
915087582 1:153398595-153398617 TCTCATCTCCAGAGGAAGTGGGG - Intergenic
917296912 1:173529526-173529548 TCTTAAGTGAAGAGGAAGAGAGG - Intronic
918119204 1:181522869-181522891 ACTCATCTGAAGAGGGGATGTGG - Intronic
919319750 1:196020936-196020958 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
919455022 1:197811067-197811089 TCTCCTTTGGAGAGGGAGAAAGG + Intergenic
919589926 1:199488773-199488795 TCACAACTAGAGAGGGAGAGGGG - Intergenic
920959363 1:210651018-210651040 TCTCATCCCTAGGGGGAGAGAGG + Intronic
923046772 1:230361580-230361602 TCTCTTGGGAACAGGGAGAGAGG - Intronic
924855264 1:247869292-247869314 CCACCTCTGAAGAGGGAGAGGGG - Intronic
1063056347 10:2509076-2509098 GCTCAGATGAAAAGGGAGAGTGG + Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1064018701 10:11792358-11792380 TCACATGTGAGGAGGGATAGAGG + Intergenic
1064030567 10:11880304-11880326 TCTCATCAGAAGAGGCTGGGAGG - Intergenic
1064215911 10:13400572-13400594 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1064903500 10:20318792-20318814 TCTCTCTTGAAGAGAGAGAGGGG - Intergenic
1065118060 10:22501326-22501348 CCTAATTTTAAGAGGGAGAGAGG - Intergenic
1066136576 10:32452992-32453014 TCTCCTCTGAAGAGAGTTAGGGG - Intronic
1066334873 10:34465636-34465658 TCTCACCTGATTAGGGAAAGGGG - Intronic
1067449736 10:46375027-46375049 TCTCATGAGAAGAAAGAGAGAGG - Intergenic
1067488268 10:46673110-46673132 CCTTTTCTGAAAAGGGAGAGAGG - Intergenic
1067606535 10:47668918-47668940 CCTTTTCTGAAAAGGGAGAGAGG + Intergenic
1067634761 10:47993837-47993859 TCTCATGAGAAGAAAGAGAGAGG + Intergenic
1067704408 10:48596373-48596395 TGTCATCTATAAAGGGAGAGGGG + Intronic
1068136036 10:52952092-52952114 TCTCGTCTGAGGAGGGGGAAGGG + Intergenic
1070665897 10:78343131-78343153 CCTCCGCTGAGGAGGGAGAGAGG - Intergenic
1070722822 10:78768390-78768412 TTACATCTGGAGAGGGAGACGGG + Intergenic
1071875029 10:89836292-89836314 TATCAGCTGAAGAGGGAGTCTGG + Intergenic
1072721373 10:97782931-97782953 TCTCATCTGTAAATGGAGTGGGG - Intergenic
1073962147 10:108944660-108944682 TAACATCTGAAGAGGGAATGTGG - Intergenic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074633845 10:115290714-115290736 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
1075425472 10:122338740-122338762 TCTCATCTGAAGAGATGGCGGGG + Intergenic
1076823925 10:132957869-132957891 TCTCATCTGAAGACCGAGGGAGG + Intergenic
1077023057 11:428221-428243 TCTCCTATGAGCAGGGAGAGAGG - Intronic
1077425441 11:2473861-2473883 TCCCATCTGTGGAGGGCGAGTGG - Intronic
1078450196 11:11435286-11435308 TCTCCTCAGAAGGGGGAGACTGG - Intronic
1078680631 11:13472414-13472436 TCCCATCTCATGAGGGAAAGAGG - Intergenic
1079411698 11:20193671-20193693 GCTAATCTGAAAAGGGAGATGGG - Intergenic
1079501395 11:21105258-21105280 TCTCTCCTGCAGAGAGAGAGAGG + Intronic
1082766389 11:57171400-57171422 TCACATCTGAAGAGGGGCTGTGG - Intergenic
1082814922 11:57501324-57501346 TCTCAGCTGAGGAGGGGGAAGGG + Exonic
1083661146 11:64252270-64252292 TCCCATCTGAACAGGGAGCTGGG - Intronic
1084567995 11:69942491-69942513 GCTCATCTCAGGAGGGAAAGTGG + Intergenic
1084681058 11:70666629-70666651 TCTCATCTGCATGTGGAGAGTGG - Intronic
1085013259 11:73156115-73156137 TCACATCTGAGAAGGGAGACAGG + Intergenic
1085034020 11:73289463-73289485 GCTCATCTGGGGAGGGTGAGTGG + Intronic
1085090404 11:73707486-73707508 TGTCAATTGAGGAGGGAGAGAGG - Exonic
1085793015 11:79512351-79512373 TCACAGCTGTAGAGGGAGGGAGG + Intergenic
1088242119 11:107783671-107783693 CCTCATCTGGAGAGGGGCAGAGG - Intergenic
1088543332 11:110936022-110936044 TCTCCTCTAAAAAGGGAGAGAGG + Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1089721266 11:120425158-120425180 TCCCATCTGCACAGGGAGAAGGG + Intronic
1090153818 11:124414681-124414703 ACTGCTCTGAAGGGGGAGAGGGG - Intergenic
1090275159 11:125413819-125413841 TCACTTCTGAAGGGGGAGAAAGG + Intronic
1090806095 11:130203260-130203282 TCTCATGGGACGGGGGAGAGGGG - Intronic
1090911380 11:131122588-131122610 TCCATTCTGAAGGGGGAGAGAGG + Intergenic
1090997709 11:131881929-131881951 TCTCTACTGGAGAGGGAGATGGG - Intronic
1091490915 12:931916-931938 TCTCATCTGAGCAGGGCAAGGGG - Intronic
1092535989 12:9387819-9387841 TCTCTGCTGAAGTGGGAGAATGG + Intergenic
1092608165 12:10143051-10143073 TATCTTCTGAAAAGGGAGAGAGG + Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1097432851 12:59530162-59530184 GCTAATATGAAGAGGGAAAGAGG + Intergenic
1099394421 12:82120694-82120716 ACTCATATGAAAGGGGAGAGTGG + Intergenic
1099940626 12:89183816-89183838 TTTCATCTGAAGATGGGGAGGGG - Intergenic
1100185386 12:92133382-92133404 TCTTGTCTGAAAAAGGAGAGAGG - Intronic
1100607664 12:96165141-96165163 TCTCAGCTGAAGAGGGCAACCGG - Intergenic
1100695136 12:97084500-97084522 TCTGAACTGGAAAGGGAGAGGGG + Intergenic
1102251605 12:111391103-111391125 TCTCACAGGAAGAGGCAGAGCGG + Intergenic
1102942863 12:116959349-116959371 TGTCATCTGAGGAGGCAGAGTGG + Intronic
1103139240 12:118534376-118534398 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
1103790736 12:123469062-123469084 TCACAACTGGAGGGGGAGAGAGG - Intronic
1103831986 12:123787659-123787681 CCTCATCGGAAAAGGCAGAGCGG - Intronic
1104346561 12:128004956-128004978 TCTCTCCTGCAGACGGAGAGGGG + Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1105803187 13:23929088-23929110 TCTGATCTCAAAAGGGAAAGAGG - Intergenic
1106150810 13:27100002-27100024 TCTACTCTGAGCAGGGAGAGGGG - Intronic
1106602911 13:31202401-31202423 TCTCATATGAACAGGGCGAATGG + Intronic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107412031 13:40166752-40166774 TCCCACCTGAAGAGGGAGAAGGG - Intergenic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1108232115 13:48356582-48356604 ACTAATCTGAAAATGGAGAGGGG - Intronic
1110662891 13:78078845-78078867 TCTCATGTGATGAGGTAGAGTGG - Intergenic
1111116150 13:83780083-83780105 TCTGCTCTGAACAGGGAAAGAGG + Intergenic
1111517717 13:89357063-89357085 TCTCAGCTGGAGAGGTAAAGGGG + Intergenic
1111919943 13:94399821-94399843 TCTCTTCTGAAGAGGAAAGGAGG - Intronic
1112389225 13:98967596-98967618 TCTCATATAAAGAGGAACAGAGG - Intronic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1117377206 14:55127809-55127831 TCTTATCTGAAGAGGTAGCCTGG - Intronic
1117514044 14:56482645-56482667 TCTCATCTGCAGAGGAATTGGGG + Intergenic
1117986379 14:61389953-61389975 TTTCATCTGAAGAGGAAGACTGG - Intronic
1118287296 14:64487555-64487577 TCACCTCTGATGAGGGTGAGGGG + Exonic
1119319052 14:73718748-73718770 TGGCATCTCAAGAGGGAGTGAGG - Exonic
1119647276 14:76356897-76356919 TCTCTCCTGAGGAGGGAAAGGGG + Intronic
1119688855 14:76654809-76654831 TCTCATGAGAAGAGGCAAAGAGG + Intergenic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1202829507 14_GL000009v2_random:11465-11487 TTTGATCTGAAGAGCTAGAGAGG + Intergenic
1126497875 15:49312548-49312570 TCTAAGCTGGGGAGGGAGAGAGG - Intronic
1126570885 15:50149367-50149389 ACTGATTTGAAGAGGAAGAGAGG - Intronic
1126885985 15:53150557-53150579 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1127539950 15:59927502-59927524 TCTCATCTGTAAAGGTAGATAGG - Intergenic
1128086700 15:64891685-64891707 TCCCATCTGCAATGGGAGAGGGG - Intronic
1128168022 15:65484581-65484603 TCTCTCCTGCAGAGAGAGAGAGG - Intronic
1129066584 15:72909835-72909857 TCTCAAGTTAAGAGGGAGAGAGG - Intergenic
1129778318 15:78251652-78251674 TCTCTCCTGGGGAGGGAGAGGGG - Intergenic
1129785425 15:78306898-78306920 TGGCATCTGTAGAAGGAGAGGGG - Intergenic
1129991498 15:79967829-79967851 TCTCATCTGAGCTGGGAAAGCGG + Intronic
1130655577 15:85789981-85790003 TTTCACCTGTAGAGTGAGAGGGG - Intronic
1130868791 15:87953775-87953797 TCTCTTCTGAAAAAGCAGAGAGG - Intronic
1130932310 15:88438272-88438294 TCTCACCTGATGAGGGACAATGG - Intergenic
1134426477 16:14152697-14152719 TCTCATCTGAAGTCTGTGAGTGG + Intronic
1134473222 16:14547209-14547231 CTTCATCTGAAGAGCCAGAGGGG + Intronic
1134844292 16:17426806-17426828 TCTCATATGACTAAGGAGAGAGG + Intronic
1135941417 16:26825373-26825395 TCTCTTTTCCAGAGGGAGAGAGG - Intergenic
1136135674 16:28255563-28255585 TGTCATCAGAAGAGGGTCAGGGG + Intergenic
1136145689 16:28315171-28315193 TCTCATCTGTAAATGGAGAGAGG - Intronic
1137660885 16:50205143-50205165 TCACATCCGAAGAGGGACTGGGG - Intronic
1138245615 16:55464895-55464917 TATCCTCTTAAGAGGGAGACGGG - Intronic
1138372944 16:56541787-56541809 TCTTTTCTCAACAGGGAGAGAGG - Intergenic
1138768196 16:59629749-59629771 TCTCATCAGAAGAGATAGTGTGG + Intergenic
1140063975 16:71594319-71594341 TCTCATTTGTGGAGGGAGTGGGG - Intergenic
1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG + Intronic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1142137067 16:88456294-88456316 TGTCACCTCCAGAGGGAGAGAGG + Intronic
1142483349 17:231724-231746 TCTTAGCTGAACTGGGAGAGTGG - Intronic
1143493921 17:7300001-7300023 TCTCAACTGAGAAGGGACAGTGG - Intergenic
1143843220 17:9751457-9751479 TCTCATATGAAAAGGTAGATTGG - Intergenic
1144083698 17:11787605-11787627 TCTGATCTGAACAGAGCGAGGGG - Intronic
1145961105 17:28886982-28887004 TCTCTTCTGGGGAAGGAGAGAGG + Intronic
1146449371 17:32960412-32960434 TCTGATTTGAAGTGGGAGTGGGG + Intergenic
1148456795 17:47815481-47815503 TCTGAGCAGAAGAGGCAGAGAGG + Intronic
1148851437 17:50557415-50557437 TCTCATCCCAGGAGGGAGAGAGG - Intergenic
1149322343 17:55494114-55494136 TCTCATGGGAAAAAGGAGAGAGG - Intergenic
1151148140 17:72060620-72060642 TCTCAAAAGAAGAGAGAGAGAGG - Intergenic
1151148156 17:72060810-72060832 TCTCAAAAGAAGAGAGAGAGAGG - Intergenic
1151378260 17:73706712-73706734 TCCCATCTGATGAGGGCAAGAGG + Intergenic
1151890238 17:76947272-76947294 TCCCATCTGTAAAGGGACAGGGG - Intronic
1152300883 17:79494923-79494945 TTTCATCTGAACAGGGAGCTGGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154020238 18:10658266-10658288 TCTCTCCTGCAGAGAGAGAGAGG + Intergenic
1157918752 18:51695110-51695132 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
1158011229 18:52730224-52730246 TCACAACTGGAGAGGGAGAAGGG + Intronic
1158326750 18:56321114-56321136 TGGCATTTGAAGAGGCAGAGAGG + Intergenic
1159061085 18:63514517-63514539 TCTCAGCTGCAGCAGGAGAGGGG - Intergenic
1159104139 18:63986376-63986398 TTTCATCTGAAGATGAAGGGAGG - Intronic
1159129953 18:64270127-64270149 TTTGATCTGAAGAGGGAAACAGG + Intergenic
1159275951 18:66221806-66221828 TAACCTCTGAAGAGGGAAAGAGG - Intergenic
1161251730 19:3284503-3284525 ACTCATGTGGAGAGGGAGACGGG + Intronic
1162121963 19:8476211-8476233 TCTCAGCTGTAGAGGGTGTGGGG - Intronic
1162880190 19:13653146-13653168 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1163215689 19:15875365-15875387 TCTCTTCTGCAGAGAAAGAGGGG - Intergenic
1163227731 19:15976693-15976715 TCTCTTCTGCAGAGAGAGAGGGG + Intergenic
1164434886 19:28220490-28220512 TCTCATGTGAAGACGGAGTGGGG - Intergenic
1164716680 19:30396222-30396244 TCCCATCAGGAGATGGAGAGAGG - Intronic
1165253180 19:34556839-34556861 TCTCATCTGAGAAGGGGAAGGGG + Intergenic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
926561640 2:14424235-14424257 AGTCATCTGAAGAGGCAGTGAGG + Intergenic
927958531 2:27224993-27225015 TATCACCTGAGGATGGAGAGGGG - Exonic
928538331 2:32261249-32261271 TCTCTCCTGCAGAGAGAGAGGGG - Intronic
929657349 2:43747304-43747326 TGTTCTCTGAAGAGAGAGAGAGG + Intronic
929870385 2:45754265-45754287 TTTCATCTGAAGAGGCAAGGAGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930705863 2:54504191-54504213 TCCAACCTGAAGAGGCAGAGAGG + Intronic
930861026 2:56072815-56072837 TCTGATATGTGGAGGGAGAGAGG - Intergenic
931432963 2:62223565-62223587 ACTCACGTGAAGAGGGAAAGCGG + Exonic
932088504 2:68783794-68783816 TTTCCTCTGAAGAGAAAGAGAGG - Intronic
933472358 2:82742143-82742165 TCTGATCTGAGGAGGGGAAGGGG - Intergenic
934097299 2:88618559-88618581 TCTCATCCTAAGAGGGAGACTGG + Intronic
934949809 2:98568423-98568445 TATGCTCGGAAGAGGGAGAGTGG + Intronic
935723306 2:105998538-105998560 TCTCTCCTGAAGAGAGAGAGGGG - Intergenic
937281042 2:120717307-120717329 TGAAATCTGAAGAGGAAGAGGGG - Intergenic
937471959 2:122181759-122181781 TCTTCTCTGAAGAGGAACAGGGG - Intergenic
938134827 2:128748028-128748050 TCTCATCTGCGGTGTGAGAGAGG + Intergenic
938272006 2:129980522-129980544 TGTCAGTTGAGGAGGGAGAGAGG + Exonic
938444001 2:131363292-131363314 TGTCAATTGAGGAGGGAGAGAGG - Intergenic
940187015 2:150997014-150997036 TGTAATCAGGAGAGGGAGAGGGG - Intergenic
940963193 2:159808846-159808868 TCTCATCTGAACAGTCAGAGAGG - Intronic
941401207 2:165033113-165033135 TCTTTTCTGGTGAGGGAGAGTGG - Intergenic
943127078 2:183806924-183806946 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
943487945 2:188511503-188511525 TCACATCTGAAGAGTGAGACAGG - Intronic
944146588 2:196513727-196513749 TCACATGTGAAGAGACAGAGCGG + Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945034502 2:205692890-205692912 TCTCATCTATAGAATGAGAGGGG - Intronic
945595108 2:211781391-211781413 TAACAACTGAAGTGGGAGAGGGG - Intronic
947451847 2:230215942-230215964 TGTGATCTGAAGAGGGAGTTGGG + Intronic
947840287 2:233203342-233203364 GCTCATCTGATGAGGATGAGGGG + Intronic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948798811 2:240420807-240420829 TCCCATCTGCAGAGGGCGTGGGG - Intergenic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1169602211 20:7274560-7274582 TCTCATCCTTAGAGGGAGAAGGG + Intergenic
1169911830 20:10653422-10653444 TTTCATCTGGGGTGGGAGAGGGG + Intronic
1170967506 20:21088155-21088177 TCTCATCTGAAGGAGGAAGGAGG - Intergenic
1171238525 20:23546929-23546951 TCACTTCTGAAGATGGAGCGTGG + Intergenic
1171367551 20:24636380-24636402 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
1172418445 20:34791809-34791831 TCTCAAAAGAAGAAGGAGAGAGG + Intronic
1174897240 20:54462664-54462686 TCTGATCTGTGAAGGGAGAGAGG + Intergenic
1176608692 21:8856307-8856329 TTTGATCTGAAGAGCTAGAGAGG + Intergenic
1176764690 21:13004823-13004845 TTACATCTGTAGAGGGAAAGAGG + Intergenic
1178271513 21:31194093-31194115 TCTCTCCTGCAGAGAGAGAGGGG - Intronic
1178374178 21:32052921-32052943 TCTCAACAAAAGAGAGAGAGTGG - Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180604716 22:17048792-17048814 TCTCTCCTGAAGTGGGAGAATGG - Intergenic
1181325600 22:22043478-22043500 TCTCACCTGAATAGTGAGGGTGG - Intergenic
1181345177 22:22214836-22214858 TCTCACCTGCAGAGTGAGTGAGG - Intergenic
1182283407 22:29231003-29231025 GGTCATCTGAAGAGGAAGACAGG - Exonic
1182957344 22:34438960-34438982 TCTCATTTTGAGAGGGAGATAGG + Intergenic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
949247846 3:1946449-1946471 TCTCATCTGTGGAGTGAGAATGG + Intergenic
949609127 3:5686134-5686156 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
949959522 3:9300663-9300685 TCTCAACAGAAGGGAGAGAGGGG + Intronic
952384937 3:32833573-32833595 TATAATCTTAAGAGTGAGAGGGG + Intronic
953419374 3:42742610-42742632 TCTCATTGTAAAAGGGAGAGGGG - Intronic
955126018 3:56113736-56113758 TGGCATCTGAAGTGGGAGGGTGG - Intronic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
957233859 3:77558960-77558982 TCTCATCTGAAGATTGACACAGG + Intronic
959500556 3:107101884-107101906 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
960842314 3:121972421-121972443 TCTCCCCTGCAGAGAGAGAGGGG - Intergenic
960860241 3:122144947-122144969 TCACGTCTGCAGAGGGAAAGAGG - Intergenic
961478532 3:127164271-127164293 ACTCCCCTGAGGAGGGAGAGTGG - Intergenic
961941037 3:130637107-130637129 TCTCATTGGAGGAGGGGGAGGGG - Intronic
962368351 3:134800848-134800870 TCTCATCTAAAAAGTGGGAGAGG - Intronic
964339175 3:155690235-155690257 TCTCATCTATAAAAGGAGAGTGG + Intronic
964888846 3:161515213-161515235 TCTAATATGCAGAGGGGGAGAGG - Intergenic
964908388 3:161746864-161746886 AGACATCTGAAGAGTGAGAGAGG + Intergenic
965446770 3:168782560-168782582 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
965643374 3:170855096-170855118 TCTCAGAGAAAGAGGGAGAGAGG + Intronic
968184149 3:196620205-196620227 TTTCATCAGAAGAGGGGTAGAGG - Intergenic
969790601 4:9491659-9491681 CCTCATATTAAGAGGAAGAGAGG - Intergenic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
970735921 4:19167753-19167775 TTTTATCTGAAAATGGAGAGAGG + Intergenic
971313547 4:25547508-25547530 TCTCATTTCATGAGGCAGAGTGG + Intergenic
971317762 4:25581506-25581528 TGGCATCTGAAGATGGAGATTGG + Intergenic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
972744998 4:41924018-41924040 TCTTTTCTGCAGAGAGAGAGGGG - Intergenic
973897937 4:55434926-55434948 CATTATCTGAAAAGGGAGAGGGG + Exonic
974356514 4:60819982-60820004 CGTCATCAGGAGAGGGAGAGTGG - Intergenic
976238805 4:82931601-82931623 TTTAATCTGAAGAGGGAGTTCGG + Intronic
976465389 4:85362564-85362586 TCTCCCCTGCAGAGAGAGAGGGG + Intergenic
977372911 4:96162842-96162864 TTTCTTCAGAAGATGGAGAGAGG + Intergenic
977611555 4:99039425-99039447 TCTCATCTGAAGATATAGAAGGG + Exonic
978491288 4:109314560-109314582 ACCCATCTGAAAAGAGAGAGGGG - Intergenic
978565188 4:110073786-110073808 TTCCATCTGAAGTGTGAGAGGGG + Intronic
978794680 4:112697372-112697394 TGTCTTCTGAGGAGGGAGAACGG + Intergenic
979410236 4:120368593-120368615 TCTCATCAGAAGAGAGATTGAGG - Intergenic
981217947 4:142193329-142193351 TCACATCTCAAGGGGGAAAGAGG + Intronic
981348025 4:143698789-143698811 TCTCAACTGAAGATGAAGACTGG - Exonic
981894625 4:149783719-149783741 TCTCATCAGACTAGAGAGAGAGG + Intergenic
982699399 4:158642863-158642885 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
982849301 4:160292378-160292400 TCTCATCTGAATGCAGAGAGAGG - Intergenic
983062739 4:163176919-163176941 ACTCCTCTGAAGAGATAGAGTGG + Intergenic
983286642 4:165748492-165748514 ACTGATCTTAAAAGGGAGAGGGG - Intergenic
983376696 4:166938161-166938183 TGTCATCTGAAGAATGACAGAGG + Intronic
984003083 4:174274393-174274415 TATCATTTAAAGAGGGCGAGAGG - Intronic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984720306 4:182966043-182966065 TAGCATCTGTAGAGGGAGAATGG - Intergenic
986444022 5:7805694-7805716 TCCCATGGGAAGAGTGAGAGTGG + Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
989796836 5:45484538-45484560 TCTCATTTTAAAAGGAAGAGAGG - Intronic
990188284 5:53230852-53230874 TGACATCAGAAGAGAGAGAGTGG - Intergenic
990398301 5:55407758-55407780 TCCCATCTCAAGAAGGAAAGAGG - Intronic
994508936 5:100678695-100678717 TCTCATCTAAAGATGGAGCTTGG + Intergenic
994992198 5:107011104-107011126 TCTCACACGTAGAGGGAGAGAGG - Intergenic
995499881 5:112793211-112793233 TCTCCTCTGAAGAGGTGGAGAGG + Intronic
996610193 5:125369808-125369830 TTGCATCTGAAGAGGGGGTGGGG - Intergenic
999143628 5:149378837-149378859 TCCCATCTGGAGAGTGAGGGAGG - Intronic
1000421816 5:161046445-161046467 TCTCCTCTGAGCAGGGAGATTGG - Intergenic
1000881487 5:166703218-166703240 TCCCACGTGAAGAGGGAGGGTGG - Intergenic
1001206982 5:169773129-169773151 TCACATCAGAACAGGAAGAGAGG - Intronic
1001422998 5:171601155-171601177 TCTCGTCTGGAGGGGGCGAGGGG - Intergenic
1002982960 6:2160266-2160288 TCTCATCAGAAGAGTGACAGTGG + Intronic
1003706913 6:8542871-8542893 TGTCATCTGAAGTGGGAGACAGG - Intergenic
1003925064 6:10870091-10870113 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1005344641 6:24877303-24877325 TCTCTCCTGGAGAGGGAGGGAGG - Intronic
1006574252 6:35032429-35032451 TCTCATCTGACTGGGGAGAAGGG - Intronic
1006767473 6:36520856-36520878 TCTCCTCTCAAGAGGTAGAAAGG + Intronic
1007371610 6:41429878-41429900 TGTGGTTTGAAGAGGGAGAGGGG - Intergenic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008073210 6:47118379-47118401 GCCCATAGGAAGAGGGAGAGAGG - Intergenic
1009500640 6:64408364-64408386 AATCACCTGAGGAGGGAGAGAGG + Intronic
1009793048 6:68428698-68428720 TATCTTCTAAAGAGGGAGATTGG - Intergenic
1010010218 6:71040348-71040370 TCTCCTCTGAGCTGGGAGAGTGG + Intergenic
1010628954 6:78174588-78174610 TCTGTTCCAAAGAGGGAGAGGGG + Intergenic
1013184250 6:107744377-107744399 TCTCATCACAAGATGGAAAGTGG - Intronic
1015176010 6:130309913-130309935 TATCATATGAAGAGAGAGAGAGG + Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020792089 7:12640330-12640352 TCGGATCTGATGGGGGAGAGGGG - Exonic
1021031610 7:15744262-15744284 TGGAATCTGAAGAGGGAGAGGGG + Intergenic
1021265516 7:18516499-18516521 TCTCATGTGAAGGAGGTGAGAGG - Intronic
1022974549 7:35545408-35545430 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1024337629 7:48225269-48225291 TCTGTGCTGAACAGGGAGAGAGG - Intronic
1024579126 7:50787792-50787814 TTTCTTCAGAAGAGGGAGTGCGG + Intronic
1026162147 7:67878845-67878867 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
1026989054 7:74572950-74572972 TTTCTTCTGAAGTGGCAGAGTGG + Intronic
1027425750 7:78060245-78060267 TCTAATCTAAAGAGGGGGGGGGG - Intronic
1027847603 7:83402277-83402299 ACTCCTCTGAAGAGGCTGAGAGG + Intronic
1029301653 7:99586275-99586297 TCTAATATCCAGAGGGAGAGAGG - Intronic
1030827561 7:114178829-114178851 TCTCATCTGAACAGAGAAACTGG - Intronic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1032721224 7:134552163-134552185 TCTCATCCGAGGAGGGAGAAGGG - Intronic
1032961940 7:137045777-137045799 TATCATCTGGAGAGGGAAAGTGG - Intergenic
1033300963 7:140185120-140185142 TCTCATTAGATTAGGGAGAGAGG - Intergenic
1033468020 7:141614714-141614736 TCTCCTCTGGGAAGGGAGAGAGG + Intronic
1033526930 7:142225521-142225543 TATCATCTGATGGGGAAGAGAGG - Intergenic
1034343551 7:150372352-150372374 TCGCAGCTGTAGAGGGAGGGGGG - Exonic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036916927 8:12813026-12813048 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
1037728895 8:21506956-21506978 TTTCCTCTGGAGAGGGAGAAAGG + Intergenic
1038321762 8:26533742-26533764 TCTCAGGTGAAGAGGTTGAGAGG + Intronic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1038652680 8:29419886-29419908 TCTATTCTGAACAGGTAGAGAGG - Intergenic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1041015845 8:53592525-53592547 ACTGAGATGAAGAGGGAGAGAGG + Intergenic
1042092400 8:65172970-65172992 TCTCATGTGACTTGGGAGAGAGG + Intergenic
1043050660 8:75381089-75381111 TCTCCTCTGAACAGAGAGAGTGG + Intergenic
1043523197 8:81068448-81068470 TCTCAGCAGAAGAGGGAAAGGGG + Intronic
1044098687 8:88102212-88102234 GCTTGTCTGAAGAGGGAGGGAGG - Intronic
1045082465 8:98642505-98642527 TCACATGTGAAGACTGAGAGTGG + Intronic
1045594283 8:103635284-103635306 TCTTATCTGAAAAGACAGAGAGG + Intronic
1045999812 8:108406157-108406179 TCTCAGTTGAAGAGGGAGTGTGG - Intronic
1047772243 8:128038900-128038922 AGACATCTGGAGAGGGAGAGAGG - Intergenic
1047916842 8:129592348-129592370 TCTGTTCTGAAGAGGCAGTGGGG + Intergenic
1048316274 8:133364851-133364873 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1048677401 8:136798974-136798996 TCTCATCTCTAAAAGGAGAGAGG + Intergenic
1049260529 8:141636592-141636614 TCTCATTTGAAGAACGAGATAGG + Intergenic
1049640590 8:143713405-143713427 CCACATCTGAAGCAGGAGAGAGG + Intronic
1050165550 9:2761123-2761145 TCTCTTCTACAGAGAGAGAGAGG - Intronic
1050196412 9:3088490-3088512 TCTCTCCTGCAGAGGGAGAGGGG - Intergenic
1051215789 9:14795905-14795927 TCTCATTTTAAGAGGCAGGGAGG - Intronic
1052264854 9:26560377-26560399 CCTCATCTGAAGAGTCAGAAAGG - Intergenic
1052767318 9:32654561-32654583 AGTCATCTGAATAGGAAGAGAGG + Intergenic
1053598752 9:39589317-39589339 GGTCCTCTGAAGAGGGAAAGGGG - Intergenic
1053738465 9:41116878-41116900 TCTAATATTAAGTGGGAGAGAGG + Intergenic
1053856502 9:42343837-42343859 GGTCCTCTGAAGAGGGAAAGGGG - Intergenic
1054689880 9:68314436-68314458 TCTAATATTAAGTGGGAGAGAGG - Intergenic
1055805261 9:80085885-80085907 TCACATCTTAAGATGGATAGTGG - Intergenic
1056276728 9:85001152-85001174 TAGCACCAGAAGAGGGAGAGGGG - Intronic
1057476825 9:95410270-95410292 TCTCCACTGAACAGGGGGAGCGG + Intergenic
1058489030 9:105475341-105475363 TCACAGCTGAAGAGGGAGAATGG + Intronic
1058911691 9:109525624-109525646 GTTCTCCTGAAGAGGGAGAGTGG - Intergenic
1059511027 9:114846978-114847000 TCTCCTCAGAAAAGGGACAGAGG + Intergenic
1059756023 9:117294082-117294104 TCTCATCTGAACATGGAAAGGGG - Intronic
1060537138 9:124399517-124399539 TCTCTTCAGAGGAGGGCGAGGGG + Intronic
1061127104 9:128684077-128684099 TCACATCTCAAGAGGGATTGGGG - Intronic
1061683596 9:132257353-132257375 TCACTTCTGCAAAGGGAGAGAGG + Intergenic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1062259003 9:135648656-135648678 TCTCACCTGCGGAGAGAGAGGGG + Intergenic
1062347165 9:136120149-136120171 TCACATCTGGAGAGGCAGAGAGG - Intergenic
1186491320 X:9975560-9975582 TCTCATCTGAAGGCTCAGAGGGG + Intergenic
1186880605 X:13862323-13862345 TCTCAGCAGAAGAGAGAGAAGGG - Intronic
1188838546 X:34987741-34987763 TCTCCTGTGAAAAGGGAGAAAGG - Intergenic
1189252407 X:39611537-39611559 TCTCATCTGTACAGCGAGTGGGG - Intergenic
1194550245 X:95289344-95289366 TCTCTCCTGCAGAGAGAGAGTGG - Intergenic
1195492048 X:105481916-105481938 TGTCCTCTGAAGAGAGGGAGTGG - Intronic
1195531908 X:105967386-105967408 TCTCAAATGAAAAGGGAAAGAGG - Intergenic
1197024625 X:121733854-121733876 TCTCCTCTGAATAGTGAAAGCGG - Intergenic
1197085008 X:122461950-122461972 TAGAATCTCAAGAGGGAGAGGGG + Intergenic
1197846211 X:130805856-130805878 TCGCAGCTGAAGAGGATGAGAGG + Intronic
1198000258 X:132427032-132427054 TCTCATATGAAGAGAAACAGAGG + Intronic
1199099914 X:143787688-143787710 GCTCACCTGAAGATGGAGATAGG + Intergenic
1199371371 X:147053410-147053432 TGTCATCTGCAGACGGAGACAGG - Intergenic
1199509892 X:148610112-148610134 GCCCATGTGAAGAGAGAGAGGGG + Intronic
1200039383 X:153354806-153354828 TAGCATCTGAGGAGGGAGTGGGG - Intronic
1201745053 Y:17362952-17362974 TCCCAGCAGAAGAGAGAGAGAGG - Intergenic