ID: 984658223

View in Genome Browser
Species Human (GRCh38)
Location 4:182343202-182343224
Sequence TGGAATTCACTGTGATTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984658223_984658227 19 Left 984658223 4:182343202-182343224 CCTTTTAATCACAGTGAATTCCA 0: 1
1: 0
2: 0
3: 43
4: 297
Right 984658227 4:182343244-182343266 CTTGCTACAATTTATTGTTTTGG 0: 1
1: 0
2: 1
3: 26
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984658223 Original CRISPR TGGAATTCACTGTGATTAAA AGG (reversed) Intronic
900130182 1:1084107-1084129 TGGAAGTCACGGGGATTAAAGGG + Intronic
900865235 1:5264133-5264155 TGGGATTCACTGTGATCATAGGG - Intergenic
901136675 1:7001520-7001542 TGGAATTCTCTGTGGTTCCAGGG - Intronic
901319367 1:8330240-8330262 CGGAATCCACTGGGATAAAACGG + Exonic
901323119 1:8351292-8351314 TAGATTTCAGTGTGGTTAAATGG - Intergenic
901736016 1:11312668-11312690 TGGATTTCACTGGAATAAAAGGG + Intergenic
903404145 1:23082300-23082322 TGGAAATGACTATGATTTAATGG + Exonic
904565973 1:31428713-31428735 AGGAATTCAGTGTGATGAGATGG + Intronic
907346046 1:53781427-53781449 TGGAGATCACTGTTATTATAAGG - Intronic
907680794 1:56561424-56561446 TGTAAGTCAGTGTGATGAAATGG - Intronic
907791612 1:57671199-57671221 TGAAACTCATTTTGATTAAAAGG - Intronic
907888558 1:58616808-58616830 TGGAATTCACTGAGAACTAAGGG - Intergenic
907968825 1:59360767-59360789 TGGAATTCACATTGTTTGAAGGG + Intronic
909130841 1:71734929-71734951 GGGAAATGACTGTAATTAAATGG - Intronic
909550284 1:76892380-76892402 GGAAAATCACTGTGACTAAAGGG - Intronic
909709580 1:78632017-78632039 TGATATTCAGTGTGATAAAATGG + Intronic
911999322 1:104810823-104810845 GATAATTCACCGTGATTAAATGG - Intergenic
915027030 1:152840889-152840911 TGAAATTCACTGTACTGAAAAGG + Intergenic
915225253 1:154406670-154406692 TGGAATTCAGTGTGATCTAGTGG - Intronic
915651147 1:157311746-157311768 TGGGTTTCACATTGATTAAATGG - Intergenic
916372371 1:164113389-164113411 TGGAAGTAACTGAGAATAAATGG - Intergenic
918230311 1:182524175-182524197 AGGAATTCGCATTGATTAAATGG + Intronic
918323496 1:183387679-183387701 TGGTATTCTCTCTGATGAAATGG + Intronic
919834659 1:201565531-201565553 TGGTATTCACTGAGATCACAAGG + Intergenic
921538316 1:216380223-216380245 TGAAATTCACTGTAGTTAAATGG + Intronic
922496158 1:226059798-226059820 TGTAAATCAATGTGATAAAAAGG + Intergenic
923120023 1:230981153-230981175 TGGAATACACCATGATTAAGAGG - Intronic
923299964 1:232631171-232631193 TGGAATTGACTCTGCCTAAATGG + Intergenic
924372208 1:243362689-243362711 TGGAAAGCAATGTGATAAAATGG - Intronic
1062980298 10:1716922-1716944 TTGAATTCACTGGGATTGGAAGG + Intronic
1065019469 10:21492635-21492657 TGTATTTCTTTGTGATTAAATGG - Intergenic
1065207265 10:23369113-23369135 AGGAAATCATTCTGATTAAATGG - Intergenic
1065458233 10:25930170-25930192 TGGAATTTAGTGTGATAAAGAGG + Intergenic
1065468899 10:26055799-26055821 TGAAAGTCACTGTCATTAAAAGG + Intronic
1066737197 10:38490226-38490248 TGGAATTGAATGTGATGAAAGGG + Intergenic
1066737223 10:38490441-38490463 TGGAATTCAGTGGAATTTAATGG + Intergenic
1066765421 10:38798194-38798216 TGGAATTGACTGTCATTGAATGG - Intergenic
1066767072 10:38812418-38812440 TGGAATTCAATGGAATTGAATGG - Intergenic
1066767714 10:38817748-38817770 TGGAATTCAATGGCATCAAAAGG - Intergenic
1066768814 10:38827037-38827059 TGGAATTGAATGGGATCAAAAGG + Intergenic
1066772867 10:38860978-38861000 TGGAATTCAATGGAATTGAAGGG + Intergenic
1066773080 10:38862795-38862817 TGGAATTCAATGGAATCAAAAGG + Intergenic
1066773573 10:38866965-38866987 TGGAATCGACTGGAATTAAATGG + Intergenic
1066773998 10:38870157-38870179 TGGAATGGACTGTCATTGAATGG + Intergenic
1066774012 10:38870268-38870290 TGGAATGGACTGTTATTGAATGG + Intergenic
1066775625 10:38883744-38883766 TCGAATTCAATGTAATCAAATGG + Intergenic
1066776792 10:38893321-38893343 TGGAATAGACTGTGATGGAATGG + Intergenic
1066938666 10:41864935-41864957 TGGAATTGAATGCAATTAAATGG + Intergenic
1066942339 10:41888213-41888235 TGGAATGCACTGGAATGAAATGG + Intergenic
1066971701 10:42317365-42317387 TGGAATTCACTCTAATGGAATGG - Intergenic
1067145914 10:43693836-43693858 TGGAATTCACTCTCCTTTAATGG + Intergenic
1069299885 10:66893557-66893579 TGCAAGTCACTGTAATTAAATGG - Intronic
1070622018 10:78020214-78020236 TGAAAGTCACTGAGATTACAGGG - Intronic
1071932902 10:90493841-90493863 TTGCATTCTCTGTGATTTAATGG + Intergenic
1072078945 10:92008873-92008895 TGGAATTCTGTGTGATGACATGG + Exonic
1073819135 10:107239906-107239928 TTGAATTCACTGCAATCAAATGG + Intergenic
1074627294 10:115204636-115204658 AATAATTCACTGTGATAAAATGG - Intronic
1075602080 10:123777193-123777215 TGGAAATCAATGTCATTAGATGG + Intronic
1077251149 11:1561272-1561294 GGGATTTCACTGTGAGTAACAGG - Intronic
1077788404 11:5411535-5411557 GGGAATTCAGAATGATTAAAAGG + Intronic
1078633151 11:13023665-13023687 TGGTTTTCACTGTGATTATGGGG + Intergenic
1079336850 11:19577625-19577647 AGGAAATAACTGTGATAAAAGGG - Intronic
1079588678 11:22156091-22156113 TTCATTTCACTTTGATTAAAGGG - Intergenic
1080354135 11:31421948-31421970 TGCAATTCAAAGAGATTAAAAGG - Intronic
1080633060 11:34097470-34097492 TGGAAATCACTGTCTTTAACAGG - Intronic
1081776992 11:45682380-45682402 AGAAATCCACTGTGATGAAAGGG - Intergenic
1084740963 11:71139332-71139354 TGGCATTCACTGTGGATTAAAGG + Intronic
1087952513 11:104240301-104240323 TGTAATTCAGTGTGAGTCAATGG - Intergenic
1091051917 11:132379994-132380016 TGGAATTCACTGTTCTTACCAGG + Intergenic
1091353789 11:134919576-134919598 GGCAAATTACTGTGATTAAAGGG + Intergenic
1093386458 12:18561550-18561572 TGGTATTAACTGAGTTTAAAAGG + Intronic
1093763227 12:22933994-22934016 TGGAAATCACTCTTATGAAATGG - Intergenic
1095285672 12:40407630-40407652 TGGAATTCAATGTGAGAATAAGG + Intronic
1095309460 12:40680599-40680621 TGGAATTCAAGGCTATTAAAGGG + Intergenic
1095941159 12:47727924-47727946 TTAAATTCACTGGAATTAAAGGG + Intergenic
1097246579 12:57610796-57610818 TGGAGGTCTCTGCGATTAAATGG - Intronic
1097480863 12:60124345-60124367 TGGAATAAACTATGATAAAATGG + Intergenic
1097482250 12:60143301-60143323 TCTAATTAACTGTGAATAAAAGG - Intergenic
1098097157 12:66970644-66970666 TGTAATCCACTGTTATTATAAGG + Intergenic
1098599470 12:72313495-72313517 TGAAATTAATTGTCATTAAAAGG + Intronic
1099675644 12:85756904-85756926 GGGAATGCACTGTGATTAGAAGG + Intergenic
1101671022 12:106873018-106873040 TGGATTCCCCTGAGATTAAAAGG - Intronic
1101857295 12:108454627-108454649 TGGAATTCACTCTGATTGGATGG + Intergenic
1102869838 12:116405307-116405329 GGGAAGTCACTGTGAGGAAAAGG + Intergenic
1103009011 12:117443456-117443478 TGGCTATCACTGTGATTAACAGG - Intronic
1103836881 12:123828878-123828900 TGTAATTTACTGTAATTGAAAGG + Intronic
1105534271 13:21249315-21249337 TGGAATACACTGTGGTGGAAAGG + Intergenic
1106801616 13:33262204-33262226 TGGAATTCAAAGTGATGAATAGG + Intronic
1106895061 13:34291032-34291054 TGGAATTCACTGACATAGAAAGG + Intergenic
1107460924 13:40601653-40601675 TAAAATTCTCAGTGATTAAATGG + Intronic
1108968566 13:56342608-56342630 TGGAATTCAAATTTATTAAAAGG - Intergenic
1110527626 13:76557414-76557436 TCAAATTCTCTGTGTTTAAAGGG - Intergenic
1110809292 13:79793609-79793631 TGGAGGTGACTGTGATTAAAAGG + Intergenic
1111567971 13:90041710-90041732 TGGAATTCTCTGTGGATAACGGG + Intergenic
1111957127 13:94771479-94771501 TGGATTTCACTTTTATTAGATGG - Intergenic
1113430518 13:110246460-110246482 TGTAAATTACTGTGTTTAAAAGG + Intronic
1114317539 14:21522531-21522553 TGGAAATTACTGTGCTTACAAGG - Exonic
1114710994 14:24778070-24778092 TGGACATTGCTGTGATTAAAAGG - Intergenic
1117842285 14:59871549-59871571 TACAGTTCACTGTGATAAAATGG + Intergenic
1119183788 14:72622007-72622029 TGGGATTCATTGTAATTAGATGG + Intronic
1120266593 14:82258816-82258838 TGGAATTAAATGAGATAAAAAGG - Intergenic
1120612711 14:86662202-86662224 TGAAATTCACTGGCATAAAATGG + Intergenic
1120886956 14:89459353-89459375 TTAAATTCACTCTGATTAAAAGG - Intronic
1123030939 14:105450709-105450731 TGGGGGTCACTGTGATTATACGG + Intronic
1202875201 14_GL000225v1_random:200598-200620 TGGAATGGACTGGGATGAAATGG + Intergenic
1124233191 15:27964636-27964658 TGGAAGTCACTGAGATTTCAGGG + Intronic
1125351604 15:38773487-38773509 TGGAACTCAGTGTGATACAACGG + Intergenic
1125981386 15:44005022-44005044 TGGATTTGGCTTTGATTAAAGGG - Intronic
1127352282 15:58165306-58165328 TTCAATGGACTGTGATTAAATGG + Intronic
1127566064 15:60189605-60189627 TGAAATTGGGTGTGATTAAATGG - Intergenic
1127655587 15:61052394-61052416 TGGAGTTAACTGTAATTCAAAGG - Intronic
1127895217 15:63292766-63292788 TGGAATGCACTTTCATTAAATGG + Intronic
1128097063 15:64965019-64965041 TGGAATTCACTGTGTCCAGAGGG + Intronic
1131220615 15:90580804-90580826 TGGCTTTAACTGAGATTAAATGG + Intronic
1131342866 15:91619194-91619216 TGGAATTCATTGTGATCCACTGG + Intergenic
1131525833 15:93151780-93151802 TGGAACTCACAGTCACTAAAGGG - Intergenic
1131935793 15:97503021-97503043 AGGAACTCATTGTGATTAAAAGG - Intergenic
1134843112 16:17417155-17417177 TGGAAATGACTGTGAGTCAATGG - Intronic
1139077839 16:63475614-63475636 TAGTATTCAATGTTATTAAATGG + Intergenic
1140661187 16:77192452-77192474 TGGAAATCAATGGGAATAAATGG + Intronic
1141295556 16:82765214-82765236 TGAAATTCACTGTGAATCAGAGG - Intronic
1145335554 17:21909464-21909486 TGGAATTCACTGGAATGGAATGG + Intergenic
1145336259 17:21915325-21915347 TGGAATTCAATGGAATCAAAAGG + Intergenic
1145336584 17:21918098-21918120 TGGAATGCACTGCAATTCAATGG + Intergenic
1145698608 17:26810212-26810234 TGGAATTCAATGGAATTGAAGGG + Intergenic
1145700451 17:26825798-26825820 TGGAATGGAATGTGATCAAATGG + Intergenic
1149026612 17:52034921-52034943 TAGAATTAACTTTGATTACAAGG + Intronic
1149282573 17:55124439-55124461 GGGAATACAATGAGATTAAATGG + Intronic
1150499137 17:65633323-65633345 AAGAATTGACTGTGATTAAAGGG - Intronic
1150750899 17:67861679-67861701 TGGAAGTAATTGTAATTAAAAGG - Intronic
1151587650 17:75020299-75020321 TGGAATTCACTGTGGAGGAAAGG - Exonic
1152895056 17:82906106-82906128 TGGAGAGCACTGTGATTACATGG - Intronic
1203178081 17_KI270729v1_random:34486-34508 TGGAATGGAATGTAATTAAATGG + Intergenic
1203193582 17_KI270729v1_random:211442-211464 TGGAATTCAATGGAATCAAAAGG + Intergenic
1203194654 17_KI270729v1_random:220429-220451 TGGAATGCACTGGAATGAAATGG + Intergenic
1203197887 17_KI270729v1_random:248935-248957 TGGAATTCACTGGAACAAAATGG + Intergenic
1203202946 17_KI270730v1_random:10872-10894 TGGAATTCAATGGAATCAAAAGG + Intergenic
1203204009 17_KI270730v1_random:19825-19847 TGGAATGCACTGGAATGAAATGG + Intergenic
1203207491 17_KI270730v1_random:49689-49711 TGGAATTCACTGGAACAAAATGG + Intergenic
1153343052 18:3995214-3995236 TAGAATTCACTGAGCTGAAATGG + Intronic
1153432800 18:5037501-5037523 GGGAATTCACAGGGAGTAAAGGG + Intergenic
1154103838 18:11502368-11502390 TGGAATTGGCTGTTATTACAGGG + Intergenic
1155635347 18:27946854-27946876 TGTAATTCACTCTTATTAATGGG + Intergenic
1157053043 18:44191972-44191994 TGGAATTAACTGTTTTTCAATGG + Intergenic
1158970600 18:62662826-62662848 AGGAAATCTCTTTGATTAAATGG - Intergenic
1159477038 18:68935217-68935239 TGGAAGCCACTGTGGCTAAATGG + Intronic
1161476298 19:4487614-4487636 TGGAATTGTCTGTGTTTAAATGG + Intronic
1167839468 19:52102980-52103002 TCAAATTCACTATAATTAAAGGG + Intergenic
925803343 2:7624522-7624544 TGTAATTCAATTTGATAAAAGGG + Intergenic
928572812 2:32626131-32626153 TGGAATTCACTTTGCTTGAAGGG + Intergenic
928838120 2:35571813-35571835 TATAATACACTGTGATTAAGTGG - Intergenic
930356656 2:50329206-50329228 TGCAAATCAATGTGAATAAAAGG + Intronic
931609402 2:64082260-64082282 TGGAATTGAATGTGGGTAAATGG - Intergenic
932471181 2:71959956-71959978 TGTAATCCTCTGTTATTAAATGG + Intergenic
934193676 2:89821942-89821964 TGGAATTGACTGTAATGAAATGG - Intergenic
935042879 2:99450934-99450956 TTGAATTCATTTTGTTTAAAAGG - Intronic
935652178 2:105391781-105391803 TGGAGTTCACAGAGAGTAAATGG - Intronic
935737696 2:106119451-106119473 GGGAATTAACTGAGATTAAACGG + Intronic
939461827 2:142506103-142506125 AGGTTTTCACTGTGACTAAATGG + Intergenic
939562784 2:143751858-143751880 TATAATTAACTGTGATCAAAGGG - Intronic
940130227 2:150372689-150372711 TGGTATTCACTGTGGTCAAGGGG - Intergenic
940917403 2:159271959-159271981 TGGGATGCAGTGTGATTAACTGG + Intronic
942596459 2:177595657-177595679 TGGAAAGCACAGTGATTAAAGGG - Intergenic
943151191 2:184115693-184115715 TGGCTTTCACTGTGAGGAAATGG + Intergenic
943789908 2:191920775-191920797 TTGAATACGCTGTGATTATAGGG - Intergenic
947298120 2:228655951-228655973 TGGAATCCTCTGTGACCAAATGG - Intergenic
947513900 2:230784514-230784536 CGGGATTCCCTGTGTTTAAATGG + Intronic
948391858 2:237617495-237617517 TGGGATTAACTGTGATTAACTGG + Intergenic
1169578682 20:6994660-6994682 TGGAATTGGCAGTGATAAAAAGG + Intergenic
1169609152 20:7359789-7359811 TCTAATTAACTGTGATGAAAAGG - Intergenic
1169681849 20:8224129-8224151 TGGAAATCATTGTGGTAAAATGG + Intronic
1170052657 20:12163752-12163774 TGGAATCCACTTGGATTGAATGG + Intergenic
1170200402 20:13737639-13737661 TGGAATCCACTCTGAGTATAAGG + Intronic
1171723019 20:28584345-28584367 TGGAAATCACAGTGATTTCAAGG - Intergenic
1171755065 20:29099107-29099129 TGGAAATCACAGTGATTTCAAGG + Intergenic
1171787622 20:29483785-29483807 TGGAAATCACAGTGATTTCAAGG - Intergenic
1171860331 20:30395596-30395618 TGGAAATCACAGTGATTTCAAGG + Intronic
1171918721 20:31080763-31080785 TGGAATTGACTGTAATACAAAGG + Intergenic
1171927212 20:31198871-31198893 TGGAATTGACTGTAATACAAAGG + Intergenic
1171931976 20:31236971-31236993 TGGAATTCACTGGAATGGAAAGG + Intergenic
1172785049 20:37463157-37463179 TGGTATTGCCTGTGGTTAAATGG - Intergenic
1173218610 20:41112225-41112247 TGGAATTCACTTAGATTTAATGG + Intronic
1175079851 20:56410258-56410280 TGAAATTCTCTGTAATGAAAAGG - Intergenic
1176525677 21:7916149-7916171 TGGAATTGAATGTAATTGAAAGG - Intergenic
1176526087 21:7919545-7919567 TGGAATTGAATGTAATCAAAAGG - Intergenic
1176636413 21:9248155-9248177 TGGAATTCAATGGGATGGAATGG + Intergenic
1176748377 21:10671511-10671533 CGGAATTCAGTGTAATTTAATGG - Intergenic
1176750478 21:10687280-10687302 TGGAATGGAATGGGATTAAATGG - Intergenic
1176754080 21:10712750-10712772 TGGAATTGAATGTGGTGAAAGGG - Intergenic
1178849903 21:36204486-36204508 TGGAATTCAATGTGATCATGTGG - Intronic
1180282573 22:10717002-10717024 TGGAATTCATTGGGTTCAAATGG - Intergenic
1180296574 22:10943015-10943037 TGGAAATCACAGTGATTTCAAGG - Intergenic
1180412097 22:12622980-12623002 TGGAAATCACAGTGATTTCAAGG + Intergenic
1180530923 22:16349436-16349458 TGGAATACACTGGGATTTAATGG + Intergenic
1180532282 22:16359170-16359192 TGGAATACAATGTAATTTAATGG + Intergenic
1182056112 22:27355965-27355987 TGGAGATCACTGTGAAGAAATGG + Intergenic
1203304888 22_KI270736v1_random:102302-102324 TGGAATTCAATGAAATTGAATGG + Intergenic
1203309053 22_KI270736v1_random:129822-129844 TGGAATACAGTGTAATGAAATGG + Intergenic
1203314207 22_KI270736v1_random:171824-171846 TGGAATGCAATGTAATTTAATGG + Intergenic
1203317361 22_KI270737v1_random:26617-26639 TGGAATACAATGTAATTTAATGG - Intergenic
1203318723 22_KI270737v1_random:36371-36393 TGGAATACACTGGGATTTAATGG - Intergenic
950382036 3:12624284-12624306 TAGAATTTTCTGTGATTAACAGG - Intronic
950810514 3:15646106-15646128 TGGAATTTTCTGTCAGTAAATGG + Intergenic
951345051 3:21537802-21537824 TGCATTTCACTTAGATTAAAAGG - Intronic
953017553 3:39092729-39092751 TGGAAATCTCTGTAATAAAAAGG - Intronic
953802724 3:46038956-46038978 TGATATTCACTTTGATTAAGTGG + Intergenic
956538692 3:70309130-70309152 TGGAAGTCACTGTAATAAAATGG + Intergenic
956944771 3:74207918-74207940 TGGAATTCAGAGTTGTTAAAGGG + Intergenic
957162335 3:76626174-76626196 TGGAAAACACTGTCATAAAATGG + Intronic
959349586 3:105244801-105244823 TGTAATTTACTGTTACTAAATGG + Intergenic
960352312 3:116608089-116608111 TGGAAAACAATGTGATGAAAGGG - Intronic
962127072 3:132631766-132631788 TGGAAGTAATTGTGATAAAAAGG + Intronic
965771197 3:172182640-172182662 TGGAATTCCCTGCGTTTAACAGG - Intronic
966501725 3:180649791-180649813 TTTAATTCTCTGTGATGAAAAGG + Intronic
970049056 4:11891760-11891782 AAGTATTCACTATGATTAAATGG + Intergenic
971312223 4:25535327-25535349 TGGAATTCACTGAGGTGACATGG - Intergenic
972173129 4:36371798-36371820 TGTGATTGACTGTAATTAAAAGG - Intergenic
973404051 4:49656604-49656626 TGGAATGCATTGGAATTAAATGG + Intergenic
973899151 4:55449610-55449632 TGGACTTCACTTTCATTGAATGG - Intronic
974138858 4:57855171-57855193 TGAAATTCAGTGTGATTCTAAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974598198 4:64040169-64040191 TGGAATTCAGAGTGAGTATAAGG - Intergenic
974905368 4:68048562-68048584 TAGAATTCACTATGAGAAAAGGG - Intergenic
975654338 4:76626602-76626624 TGGCATTGACTCTGAATAAATGG - Intronic
980174103 4:129324450-129324472 TGGACATCACTGTGGTTCAAGGG + Intergenic
981582688 4:146266304-146266326 TGGATTGCACTGTGCTTAAAGGG - Intronic
982890565 4:160844223-160844245 GGAAATTAAATGTGATTAAAAGG - Intergenic
983314152 4:166105976-166105998 TTGAATTCCCTGGGATTAAAAGG + Intergenic
983484936 4:168322348-168322370 TGGAATTTACTGGGATTTGAGGG - Intergenic
984547616 4:181126381-181126403 TGGAATTAGCTGTTATTTAAGGG - Intergenic
984658223 4:182343202-182343224 TGGAATTCACTGTGATTAAAAGG - Intronic
984770363 4:183432030-183432052 GGGAATTCACAATGCTTAAAAGG - Intergenic
985438497 4:189959418-189959440 TGGAAATCACAGTGATTTCAAGG + Intronic
1202751307 4_GL000008v2_random:6640-6662 TGGAATTCAATGGGATGGAATGG + Intergenic
987360656 5:17103482-17103504 TGGAATTCACTTTGATTTTATGG - Intronic
992268007 5:75036888-75036910 AGCAATTCTCTGTGCTTAAATGG - Intergenic
994368064 5:98938625-98938647 TGGAATGCACTGTGTGTATAGGG + Intergenic
995034535 5:107518347-107518369 TGGAGGTCACTGTGATTGACAGG + Intronic
995065454 5:107857090-107857112 TGTAGTTCACTGTTTTTAAAAGG + Intergenic
995066233 5:107866240-107866262 AAGAAATTACTGTGATTAAAGGG + Intronic
996333430 5:122356973-122356995 TGGAATTTACTGTGATGCACAGG - Intronic
996492612 5:124115823-124115845 TGCAAATCACTGTGATAGAAGGG + Intergenic
996591855 5:125157167-125157189 TCGAATTCATTGTAATTAAAAGG + Intergenic
998614144 5:143720859-143720881 TGGAAGTCACTGTGAGTGACAGG + Intergenic
999028824 5:148267112-148267134 TGCTCTTCACTGTGATTACAAGG + Intergenic
1000491325 5:161917571-161917593 TGGTATTCTGTGTGATGAAATGG + Intergenic
1000545042 5:162588913-162588935 ATGAATCCACTTTGATTAAAGGG + Intergenic
1000758887 5:165196216-165196238 TGGATTTCACTGTGAATATAAGG - Intergenic
1000926860 5:167204615-167204637 TCGAATTCACTGTGATGCCAGGG + Intergenic
1001127128 5:169029821-169029843 TGGAATCCACTGTAATTTAGGGG + Intronic
1001550922 5:172601900-172601922 TGAGATTCACTGTGATTGAATGG + Intergenic
1003169495 6:3709918-3709940 TGGAATTTGGTGTGATTAAAAGG - Intergenic
1003344114 6:5249847-5249869 TGGGATTCAGTGTGAAGAAAGGG + Intronic
1003972671 6:11313910-11313932 TGCAATAGACTGTGATTATAGGG + Intronic
1004349812 6:14881145-14881167 TGAAATTTTCTTTGATTAAAAGG + Intergenic
1005806747 6:29480557-29480579 TGAAATACACTATGATCAAAGGG + Intergenic
1010043813 6:71418756-71418778 TAGAATTCACTCTCATGAAATGG + Intergenic
1011402301 6:86976805-86976827 TTGAATTCAAAGTGATAAAAAGG - Intronic
1011534964 6:88366787-88366809 AGAAATCCACTGTGATGAAAAGG - Intergenic
1014623126 6:123693921-123693943 TGGCATTTACTGGAATTAAAAGG + Intergenic
1015234880 6:130959247-130959269 TTGAATTCATTGTGATTGAGAGG + Intronic
1016196753 6:141353361-141353383 TGGAATTCGCTGTGACTTGAGGG + Intergenic
1016204049 6:141451721-141451743 TGGAATTCAGTGGAATTCAATGG + Intergenic
1016204050 6:141451731-141451753 TGGAATTCAATGGAATTCAATGG + Intergenic
1017643515 6:156517000-156517022 TGGTATTCACAGTGTTTTAAAGG + Intergenic
1017895911 6:158679676-158679698 TGGAATTAAATGAGATTAGATGG + Intronic
1018102374 6:160452444-160452466 TGCAAGTGACTGTGAATAAAGGG - Exonic
1018133413 6:160754008-160754030 TGCAAGTGACTGTGAATAAAGGG + Intergenic
1019670018 7:2272498-2272520 TGGAATTAGCTGGGATTACAGGG + Intronic
1020481825 7:8670569-8670591 TGAATTTCATTGAGATTAAATGG - Intronic
1020506869 7:9001903-9001925 ATGCATTCATTGTGATTAAATGG + Intergenic
1022168935 7:27803770-27803792 TAGTATTCTGTGTGATTAAACGG + Intronic
1022216585 7:28268709-28268731 TGGATTTCACAGTGATTACTTGG - Intergenic
1023324259 7:39035620-39035642 TGGGATTCCCAGTTATTAAAGGG + Intronic
1024197276 7:47071542-47071564 TGGCATTCACTGAGAATAAAAGG + Intergenic
1028525945 7:91786860-91786882 CAGAAGTCACTGAGATTAAAGGG + Intronic
1031790785 7:126100927-126100949 TTGAATTCACTGAGATAAAATGG + Intergenic
1032947038 7:136866170-136866192 TGCCATTCACTGTGATTTTAGGG - Intergenic
1033782252 7:144685178-144685200 TGGAATTAACTGTGCTTCCAAGG + Intronic
1034232161 7:149538983-149539005 GAGAATCAACTGTGATTAAAGGG - Intergenic
1036235959 8:7039681-7039703 TGGAATTCACGGTGATGATAAGG + Intergenic
1042252555 8:66771536-66771558 GGGAATTTACTGTGATTCAAGGG + Intronic
1044722853 8:95167634-95167656 TGGAATTGAGTTTGATCAAAGGG + Intergenic
1049266951 8:141672692-141672714 TGGAATTCAGTTTGATGACAGGG - Intergenic
1053297642 9:36926246-36926268 TTGATTTCACTGTGTTTTAATGG - Intronic
1053747516 9:41214754-41214776 TGGAAATCACAGTGATTTCAAGG + Intergenic
1054338867 9:63835771-63835793 TGGAAATCACAGTGATTTCAAGG - Intergenic
1054479769 9:65650614-65650636 TGGAAATCACAGTGATTTCAAGG - Intergenic
1055154369 9:73042248-73042270 TGGGATTCACTGAGGTTAAGTGG + Intronic
1056022506 9:82455083-82455105 TGCAATTGATTGTGAGTAAAAGG - Intergenic
1060070219 9:120540583-120540605 TGGAATTCAATGTGAACAACTGG + Intronic
1060833694 9:126738888-126738910 TGGAATTCACTGGGCTTATCAGG - Intergenic
1062150984 9:135018904-135018926 TGTAATTAACTGGGATTAAAAGG - Intergenic
1062728085 9:138089309-138089331 TTTAATTCACTGTGATCAAATGG + Intronic
1202783648 9_KI270718v1_random:25525-25547 TGGAAATCACAGTGATTTCAAGG + Intergenic
1202803427 9_KI270720v1_random:24042-24064 TGGAAATCACAGTGATTTCAAGG - Intergenic
1203720360 Un_GL000216v2:9102-9124 TGGAATTCAATGGAATTGAATGG - Intergenic
1203724065 Un_GL000216v2:35314-35336 CGGAATTAACTGTGATGAAAAGG - Intergenic
1203729081 Un_GL000216v2:74731-74753 TGGAATGGACTGGGATGAAATGG - Intergenic
1203389987 Un_KI270438v1:88795-88817 TGGAATTGACTGTAACAAAATGG + Intergenic
1203343746 Un_KI270442v1:16860-16882 TGGAATTCACTGCAATTGAATGG + Intergenic
1203347745 Un_KI270442v1:47182-47204 TGGAATTCAGTGGAATGAAATGG + Intergenic
1203673893 Un_KI270756v1:5164-5186 TGGAATTGACTGGAATTGAACGG - Intergenic
1203675736 Un_KI270756v1:20811-20833 TGGAATAGACTGTGATGGAATGG - Intergenic
1203677168 Un_KI270756v1:32520-32542 TCGAATTCAATGTAATCAAATGG - Intergenic
1203678799 Un_KI270756v1:46151-46173 TGGAATGGACTGTCATTGAATGG - Intergenic
1203679227 Un_KI270756v1:49392-49414 TGGAATCGACTGGAATTAAATGG - Intergenic
1203679728 Un_KI270756v1:53578-53600 TGGAATTCAATGGAATCAAAAGG - Intergenic
1203679941 Un_KI270756v1:55395-55417 TGGAATTCAATGGAATTGAAGGG - Intergenic
1185993863 X:4922181-4922203 TAGAATATACTGAGATTAAATGG + Intergenic
1186632290 X:11362825-11362847 TAAAATTCACTGGGATTAACAGG + Intronic
1186944822 X:14554050-14554072 TGTAATTCAATTTTATTAAAAGG - Intronic
1188024236 X:25192247-25192269 AGGAACTCACCGTTATTAAATGG - Intergenic
1188373326 X:29395857-29395879 TGAACCTCACTGTGATTAATAGG + Intronic
1191067075 X:56359872-56359894 TGGTGTTTACTGTGAGTAAAGGG - Intergenic
1191971494 X:66821912-66821934 TGGACTTTACTGTGAGTAAGAGG - Intergenic
1194060685 X:89192981-89193003 TGGAATTGAATATGAATAAAAGG + Intergenic
1197823594 X:130565762-130565784 TGGAATTCACCGTTCTTAGAAGG - Intergenic
1198639222 X:138738157-138738179 TGTAATTAACTGGGATTAATAGG - Intronic
1199230225 X:145428550-145428572 TTGAATTCACTTTGATAAACTGG + Intergenic
1199609800 X:149603189-149603211 TGAAATTAACTGTGAATAAATGG - Intronic
1201097545 Y:10632943-10632965 TGGAATTGACTGGAATTAAAGGG - Intergenic
1201098257 Y:10651719-10651741 TGGAATTGACTGGAATTAAAGGG - Intergenic
1201101441 Y:10678415-10678437 TGGAATGGACTGGGATTTAATGG - Intergenic
1201104838 Y:10755822-10755844 TGGAGTTCAATGGAATTAAATGG - Intergenic
1201109214 Y:10786696-10786718 TGGAATACAATGGGATTGAATGG - Intergenic
1201109420 Y:10788293-10788315 TGGAATGCATTGGGATTTAATGG - Intergenic
1201117697 Y:10847267-10847289 TGGAATTGAATGGAATTAAATGG - Intergenic
1201121286 Y:10875490-10875512 TGGAATTCAATGGGATGGAATGG - Intergenic
1201145624 Y:11063825-11063847 TGGCATTCACTGTGGATTAAAGG + Intergenic
1201196442 Y:11499130-11499152 TGGAATTGACTGCTATTTAATGG + Intergenic
1201196640 Y:11500843-11500865 TGGAATTGAATGTAATCAAAAGG + Intergenic
1201197814 Y:11511479-11511501 TGGAATTCAATGCAATTGAATGG + Intergenic
1201199204 Y:11523931-11523953 TGGAATGGACTGGAATTAAATGG + Intergenic
1201208155 Y:11652518-11652540 TGGAATGCACTGTAATGGAATGG + Intergenic
1201210402 Y:11675380-11675402 TGGAATTGACTGGAACTAAATGG + Intergenic
1201211666 Y:11686505-11686527 TGGAATGCACTGGAATGAAATGG + Intergenic
1201216870 Y:11730559-11730581 TGGAATTGAATGTAATCAAAAGG + Intergenic
1201217430 Y:11735382-11735404 TGGAATTGAATGGGATTAAAAGG + Intergenic
1201327586 Y:12780896-12780918 TTGAACTTACTGTCATTAAATGG + Intronic
1201580863 Y:15511008-15511030 TAGAAGTCAGTGTAATTAAAAGG - Intergenic