ID: 984661654

View in Genome Browser
Species Human (GRCh38)
Location 4:182381316-182381338
Sequence CTGTCAACATGTAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 194}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984661643_984661654 25 Left 984661643 4:182381268-182381290 CCCTAGTGTGTCTCCCTAGCTCC 0: 1
1: 0
2: 1
3: 9
4: 149
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661647_984661654 4 Left 984661647 4:182381289-182381311 CCCTGACCACTCCAGTTAGTTAT 0: 1
1: 0
2: 0
3: 4
4: 126
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661645_984661654 12 Left 984661645 4:182381281-182381303 CCCTAGCTCCCTGACCACTCCAG 0: 1
1: 0
2: 2
3: 13
4: 276
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661650_984661654 -7 Left 984661650 4:182381300-182381322 CCAGTTAGTTATATCTCTGTCAA 0: 1
1: 0
2: 0
3: 10
4: 148
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661648_984661654 3 Left 984661648 4:182381290-182381312 CCTGACCACTCCAGTTAGTTATA 0: 1
1: 0
2: 0
3: 1
4: 72
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661649_984661654 -2 Left 984661649 4:182381295-182381317 CCACTCCAGTTAGTTATATCTCT 0: 1
1: 0
2: 0
3: 10
4: 185
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661646_984661654 11 Left 984661646 4:182381282-182381304 CCTAGCTCCCTGACCACTCCAGT 0: 1
1: 0
2: 1
3: 29
4: 289
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194
984661644_984661654 24 Left 984661644 4:182381269-182381291 CCTAGTGTGTCTCCCTAGCTCCC 0: 1
1: 0
2: 0
3: 13
4: 220
Right 984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG 0: 1
1: 0
2: 2
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984661654 Original CRISPR CTGTCAACATGTAAGGAGGA GGG Intronic
900306866 1:2014405-2014427 CAGACGACATGTGAGGAGGAAGG + Intergenic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
901237521 1:7675519-7675541 CTTTCCAGATGTAAGGAGAAGGG + Intronic
902425577 1:16318949-16318971 CTGTCCATCTGTAAGGAGGCTGG - Intronic
902606295 1:17571178-17571200 CTGCCAACCTGGAGGGAGGAAGG + Intronic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903803542 1:25988181-25988203 CTGTCACCAGGCAAGGAGTATGG + Intronic
906214766 1:44032083-44032105 GTCTCACCATGGAAGGAGGAGGG - Intergenic
907050408 1:51326260-51326282 ATGGCATCATGGAAGGAGGATGG + Intronic
909480545 1:76125269-76125291 CAGGGAACAGGTAAGGAGGAGGG - Intronic
910571650 1:88711802-88711824 CAGTCAAAATTTCAGGAGGAAGG + Intronic
911527181 1:99002134-99002156 CTGTCACCATGTGAGGAGCTGGG - Intronic
911841862 1:102693163-102693185 CTTTTAACATGTATGGAGGCGGG + Intergenic
913152687 1:116061013-116061035 CTCTCAACTTGAAAGGAGGGAGG - Intronic
916196401 1:162227516-162227538 CAGTCAACTTGCAAGGAGCATGG - Intronic
917137403 1:171800858-171800880 ATGTCACAAGGTAAGGAGGAAGG + Intronic
917587807 1:176445721-176445743 CTGTCATCATGGAAAGAGGGTGG - Intergenic
920613594 1:207467000-207467022 GTGTGAACATGTAATGATGAGGG + Intronic
921482493 1:215679067-215679089 CTGTCCACATGTAGGCAGGCTGG + Intronic
922318740 1:224465686-224465708 ATGTCAACATTGAGGGAGGAGGG - Intronic
922922618 1:229319554-229319576 CTGTGAACATGTGAGTAGGTGGG + Intergenic
923115805 1:230936407-230936429 CTGTCAACTAGTAAGAAAGATGG - Intronic
923541943 1:234894601-234894623 CTGTCAACAACTCAGGAAGACGG + Intergenic
923925495 1:238622285-238622307 ATGACAACATGGAAGGAGAAAGG - Intergenic
924158307 1:241204226-241204248 CAGTCAACACCCAAGGAGGAGGG + Intronic
1063565970 10:7172341-7172363 TTTTCAGCAAGTAAGGAGGAGGG + Intronic
1064439460 10:15340601-15340623 CTGGCATCCTGTTAGGAGGAAGG + Intronic
1065447732 10:25820805-25820827 CTATCCACATATAAGTAGGAAGG - Intergenic
1066223311 10:33357230-33357252 CTGTCATCATGTAAGAAGTGAGG + Intergenic
1068324890 10:55471952-55471974 CGGCCAATATGGAAGGAGGATGG + Intronic
1068890670 10:62145643-62145665 CTGTCAACATGTAAAGAGCTTGG - Intergenic
1068956150 10:62819674-62819696 CTTTCTACAGGCAAGGAGGAAGG + Intronic
1068993698 10:63178726-63178748 TTGTCAACATTTTAGAAGGATGG - Intronic
1069424100 10:68274596-68274618 CTGTCAAGGTGTCAGCAGGATGG + Intergenic
1069912198 10:71766375-71766397 CTGCCACCAGGTAAGGAGGCAGG + Intronic
1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG + Intronic
1073730452 10:106281373-106281395 CTGTTGCCATGGAAGGAGGACGG + Intergenic
1077891316 11:6419864-6419886 GTGTAAAGATGTAAGGAAGATGG + Intergenic
1077919732 11:6633162-6633184 CTTTCAAAATATTAGGAGGAGGG + Intronic
1078848722 11:15144588-15144610 CTGTCAACATGGAAGGGACAGGG - Intronic
1079145067 11:17843769-17843791 CTGTGAACCTCTGAGGAGGAGGG - Intronic
1079984573 11:27187203-27187225 CTGCCTACTTGTAAGGAGAAAGG + Intergenic
1080998317 11:37633778-37633800 CACTCAACATGTAAGCAGAAGGG - Intergenic
1081388403 11:42500524-42500546 TTGTCCAGATATAAGGAGGAGGG + Intergenic
1082881682 11:58044303-58044325 ATGTCACCAGGTAAGGAGGGAGG - Intronic
1084166591 11:67377671-67377693 ATGTCACCATGTGGGGAGGAAGG - Intronic
1085110358 11:73882376-73882398 ATGTCAACTCTTAAGGAGGAGGG + Intronic
1087604003 11:100352529-100352551 CTGTCAACATTTAAGGAATCTGG + Intronic
1088547834 11:110979493-110979515 CTGTGAGCAAGAAAGGAGGAAGG - Intergenic
1089607584 11:119650564-119650586 CTGGCATCAGGGAAGGAGGAAGG - Intronic
1093650112 12:21633741-21633763 CTGTCTAGATGTAAGGAGGAGGG - Intergenic
1093740523 12:22680105-22680127 CTGTTAACATGTAAGAGGGCTGG - Intronic
1093768777 12:22996353-22996375 CTTGCAACAAGTAAGGAGTAAGG + Intergenic
1094438344 12:30446634-30446656 CTATCAGCATTTAAAGAGGAAGG - Intergenic
1096009247 12:48198866-48198888 TTGTCAACATGGATGGCGGAAGG - Intergenic
1096391052 12:51229348-51229370 ATGTCAACATTTTAGGAGGCCGG - Intergenic
1099860208 12:88217143-88217165 TTGTCAGCAAGTCAGGAGGAGGG + Intergenic
1101517568 12:105451138-105451160 CTGTATACATGTAGAGAGGAAGG - Intergenic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1101789566 12:107914487-107914509 CTGTCATCATGTAAAGATGATGG + Intergenic
1101952847 12:109189772-109189794 CTGTCAGCAGGTAACGGGGAAGG - Intronic
1104900691 12:132188228-132188250 CTGACAACCTGCAAGGAGGCCGG + Intergenic
1106021950 13:25924107-25924129 CAGACAACGTGGAAGGAGGAGGG - Intronic
1107746545 13:43516425-43516447 CTATCAACATGTAAGCAGATGGG + Intronic
1109074791 13:57821274-57821296 CTCTCAAAAGGTGAGGAGGATGG + Intergenic
1110242206 13:73281850-73281872 TTTTCAACTTGCAAGGAGGAAGG + Intergenic
1112242945 13:97700339-97700361 ATGTTAACATGTTAGGAGTAGGG + Intergenic
1112664204 13:101551063-101551085 CTGTCATCATGTAGGCATGATGG + Intronic
1112983750 13:105420484-105420506 ATGTCAATGTGTAAGGATGATGG - Intergenic
1118818836 14:69331577-69331599 CTGTAGACATGAAAGGAGGTAGG + Intronic
1120503405 14:85324491-85324513 CTATTAATATGTAAGGAGTAAGG - Intergenic
1121246040 14:92461493-92461515 CTGTCTACAAGTCAGGAAGAGGG - Intronic
1122510226 14:102260581-102260603 ATGTTAAAATGTAAGGAGAATGG - Intronic
1127822713 15:62674173-62674195 CTGTTAACATGCATTGAGGAAGG + Intronic
1128858463 15:71042570-71042592 TTTTCAAGATGTAAGGAGCATGG - Intronic
1130024827 15:80261999-80262021 CTGTCACCTTCTAAAGAGGAAGG + Intergenic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1132285924 15:100662275-100662297 CTGTCAAGATGTAAGGGAGAGGG + Intergenic
1133295745 16:4751413-4751435 CAGGCAACATGTCAGGAAGATGG + Exonic
1133534742 16:6690930-6690952 CTGTCAACCTGTGATGAGGTTGG + Intronic
1134490384 16:14691661-14691683 TTGTCACTGTGTAAGGAGGAAGG - Intronic
1134495765 16:14730778-14730800 TTGTCACTGTGTAAGGAGGAAGG - Intronic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1139147487 16:64341737-64341759 CTGTCAAGAAGAAAGAAGGAAGG - Intergenic
1140131124 16:72162753-72162775 CTGGCAACTTGGAAGGAGAAAGG - Intronic
1142874041 17:2840495-2840517 CTGTTCACATCTAAGGAGCAGGG + Intronic
1145011304 17:19369871-19369893 CTCTGAACATCTCAGGAGGAGGG - Intronic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1151847580 17:76668083-76668105 CTGTCATCATGTATGGGGGTGGG + Intergenic
1152631439 17:81412432-81412454 CTCTCAACTTGTTAGAAGGATGG - Intronic
1153203098 18:2666587-2666609 GTGTCAACATGAATGGAGAATGG - Intronic
1153631520 18:7075283-7075305 CTGTGAACAAGAAAAGAGGAGGG + Intronic
1156441001 18:37187540-37187562 CTGTCAAAATGTAGAAAGGATGG - Intronic
1156997675 18:43486866-43486888 CTGTCCACCTGCAAGGTGGATGG - Intergenic
1157575618 18:48741285-48741307 CTGGCAACATGTACCAAGGAGGG - Intronic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1167117508 19:47496810-47496832 CTGTTTACATGTCAGAAGGAGGG - Intronic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
927710378 2:25321932-25321954 CTGTCAATATTTAAGGAGGATGG + Intronic
927957126 2:27215383-27215405 CTGTCATCATGTAAGTAGTTAGG + Exonic
931904646 2:66829516-66829538 CTCTCGACATGTAAGCAGCACGG - Intergenic
932294185 2:70610414-70610436 CTGTCCACATGCAAGGAAGAGGG - Intronic
937854761 2:126664250-126664272 CTGTCACCAGATGAGGAGGATGG - Intronic
939291814 2:140205476-140205498 GTGTCAAAAAGTAAGGAAGAAGG - Intergenic
939321918 2:140634480-140634502 CAGTCCACATCTAAGGAGTAAGG - Intronic
942595149 2:177585364-177585386 CTGTCACACTGTACGGAGGAGGG + Intergenic
942685609 2:178528235-178528257 CCTTAAACATGTAAGGAAGAAGG + Intronic
944332631 2:198489468-198489490 CAGTCAATATTTAAGGAGTAGGG + Intronic
945644918 2:212479211-212479233 CTGTCAACATGGCAGGAAGATGG - Intronic
946115548 2:217458820-217458842 CAGGCCACATGTAAGGAAGAGGG + Intronic
947077677 2:226363816-226363838 CTGTCAAAAGGAAAGAAGGAAGG + Intergenic
948241436 2:236440083-236440105 CTGTCAACTTCTCAAGAGGAAGG - Intronic
1169281166 20:4268060-4268082 CTGTCTACAAGTCAGGAGGCAGG - Intergenic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1173408226 20:42785939-42785961 CTCTCAACATGTAGGGATTATGG - Intronic
1175467350 20:59198370-59198392 CTGTTGCCATGTAAGGAGGCAGG - Intronic
1182837218 22:33352141-33352163 CTGACACAATGTGAGGAGGAGGG + Intronic
1184938952 22:47746868-47746890 CTGTAAACATCTAAGGACCATGG + Intergenic
949156148 3:829618-829640 CTCTCAACATGTGAGGATTATGG + Intergenic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
953021889 3:39119879-39119901 ATGTCAACATGCAAGGTGCAAGG - Intronic
954819624 3:53314546-53314568 CAGGCAACATGTCAGGAGGTAGG - Intronic
957561701 3:81830374-81830396 CTATCAACATGGTAGGAAGATGG - Intergenic
958017313 3:87954720-87954742 ATATAAACATGTAAGGAGAATGG + Intergenic
961039435 3:123666894-123666916 CTGTCAACATGGGAGGCAGATGG + Intronic
961793722 3:129394472-129394494 CTGTCAACATCAAAGGAGCTGGG - Intergenic
961809958 3:129515919-129515941 CTGTCAACATCAAAGGAGCTGGG - Intronic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
966058784 3:175730202-175730224 CTGTCAATATCTAAAGAGTAGGG - Intronic
968267727 3:197375635-197375657 CTGACAACAGCTAAAGAGGAAGG + Intergenic
971229774 4:24791841-24791863 GTGCCAACATTTAAAGAGGAGGG + Intronic
971550333 4:27947073-27947095 ATGTCAACATGTAATTAAGAAGG + Intergenic
972936380 4:44141015-44141037 CTGCCAACATGTCAGGAGTGAGG - Intergenic
978538540 4:109789849-109789871 CTTTCAAAAGGTAAAGAGGAGGG - Intronic
979333515 4:119442621-119442643 CAATAAAAATGTAAGGAGGAAGG + Intergenic
979626750 4:122853485-122853507 AAGACAAGATGTAAGGAGGAAGG + Intronic
980209389 4:129766211-129766233 CTGTCAAGAGTTAAGGAGGTGGG + Intergenic
983835895 4:172383812-172383834 CTCTTATCATGTAAGGATGATGG + Intronic
984661654 4:182381316-182381338 CTGTCAACATGTAAGGAGGAGGG + Intronic
984875065 4:184360284-184360306 CTGGCAACATGTCAGGAGCAGGG + Intergenic
985934794 5:3088944-3088966 TTGTAAACATTTAAGGATGAAGG - Intergenic
988459724 5:31423377-31423399 CTGGGAACATGTCAGGAAGACGG - Intronic
991029771 5:62070840-62070862 CTGTCCACCTGGAAGGAGCACGG + Intergenic
991130270 5:63114873-63114895 TTGTCCTCAAGTAAGGAGGAAGG + Intergenic
992385332 5:76279229-76279251 CTGTGAAGATGTAAGTAGGCAGG + Intronic
994814826 5:104572289-104572311 ATGTCAACATGTAAAAAAGAAGG - Intergenic
995311517 5:110717640-110717662 CTCTCAACATGTGAGGATTATGG - Intronic
995926850 5:117385364-117385386 CTCACATGATGTAAGGAGGAAGG - Intergenic
996826138 5:127683418-127683440 ATGTCAATAAGTTAGGAGGAGGG + Intergenic
997160146 5:131600223-131600245 GTGTTAACATGTAATGAGGCTGG + Intronic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
998574629 5:143300525-143300547 CGCTCAACATGTTAGGAGGGCGG - Exonic
999090168 5:148929090-148929112 CTTTCAACAGGTAAGGAATAAGG - Intronic
1002478257 5:179482355-179482377 TTGACACCATGTAAGGAGGGAGG - Intergenic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003009295 6:2411198-2411220 AGGTCTACATGTAAAGAGGAAGG + Intergenic
1003454892 6:6272690-6272712 CTGTCAACATCTTAGGACCATGG - Intronic
1004111844 6:12726423-12726445 CAGTAAACATCTAAGAAGGAAGG - Intronic
1004973561 6:20938933-20938955 ATGACAACATGAAAGGAAGAAGG - Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1005810525 6:29511963-29511985 CTGACACCATGTAAAGAAGAAGG - Intergenic
1007296366 6:40824645-40824667 CCGTCTACATGCAGGGAGGAAGG + Intergenic
1008134680 6:47760756-47760778 CTGTCAAAATTTAAATAGGAGGG - Intergenic
1012432178 6:99175450-99175472 CTGTCATCATTGATGGAGGATGG + Intergenic
1012770888 6:103433840-103433862 CTATCAACATGTAAAAATGAAGG + Intergenic
1013027115 6:106286567-106286589 CTGCCCACATGCAAGGGGGAAGG - Intronic
1014017802 6:116553661-116553683 CTTTAAACATGTAAGGATGTTGG + Intronic
1015054263 6:128881115-128881137 CTGGGAAAATGTAAAGAGGAAGG + Intergenic
1015845671 6:137518397-137518419 CTGTCTACATGTAAGGAGCTTGG - Intergenic
1018568995 6:165187069-165187091 CTGTCAACATGTTTGGGGCAGGG - Intergenic
1020943363 7:14568547-14568569 CTGTCAAGATGGAAGGAGCCTGG + Intronic
1021400021 7:20199035-20199057 CTGCCAGTATGTAAGGAGAATGG + Intronic
1023150469 7:37197035-37197057 ATGTAAACATTTAAAGAGGAGGG + Intronic
1024142440 7:46475789-46475811 GGGTCAACCTGTAAGGAGGGTGG - Intergenic
1024212609 7:47218638-47218660 CTGGCAACACCCAAGGAGGAAGG - Intergenic
1026614178 7:71887080-71887102 GTGTGAAGGTGTAAGGAGGATGG + Intronic
1027932923 7:84562812-84562834 CTTACCACCTGTAAGGAGGAAGG - Intergenic
1030881787 7:114889041-114889063 CTGTCAAAATCTAAGAAGGAAGG - Intergenic
1030881802 7:114889132-114889154 CTGTCAAAATCTAAGAAGGAAGG - Intergenic
1031303295 7:120090965-120090987 CTGTTTAAATGAAAGGAGGAAGG - Intergenic
1031814141 7:126411605-126411627 CAGTCAGCATTTAAGAAGGAAGG - Intergenic
1033446443 7:141426565-141426587 GTGTCATCATGGAAAGAGGAAGG + Intronic
1034755456 7:153614036-153614058 TTTTCAACATGTAAGAAGCAAGG + Intergenic
1037885019 8:22591405-22591427 GTGGCACCAGGTAAGGAGGAAGG - Intronic
1037991123 8:23321886-23321908 ATGTTAACATGCAAGGAGGCAGG + Intronic
1038036759 8:23692656-23692678 CTGTCAACATCCAAATAGGAAGG + Intergenic
1038382334 8:27107623-27107645 CTGTAAACATGTAAGGAGCCAGG - Intergenic
1039099934 8:33930109-33930131 GTGTTAACATGAAAAGAGGAGGG - Intergenic
1039299348 8:36192626-36192648 CTGTCAACCTGTGAAGAGGATGG - Intergenic
1040920890 8:52615521-52615543 TTGTCAGCATTTAAGGAGTAAGG + Intergenic
1041339340 8:56825889-56825911 CATTCAACATGTAAGGAGCTTGG + Intergenic
1041357498 8:57015600-57015622 CTGACAACACATAAGGAAGATGG + Intergenic
1044077813 8:87845330-87845352 CTGTCTATAAGTCAGGAGGATGG - Intergenic
1044116196 8:88337245-88337267 CTGTCTACATGCCAGGAAGAAGG - Intergenic
1045085489 8:98678924-98678946 CTATCAAAATATAAGCAGGAAGG - Intronic
1046547799 8:115673557-115673579 CAGACAACATGGAAGGAGGAAGG + Intronic
1049004647 8:139847108-139847130 CTGACAACAGGGAAGGAAGAAGG + Intronic
1052799421 9:32953894-32953916 CTGTAAACATCTAAGGACCATGG + Intergenic
1053002351 9:34584042-34584064 CTCTGAAGAGGTAAGGAGGAGGG + Intronic
1053265111 9:36706849-36706871 CTATCATCATGCAAGGAAGATGG + Intergenic
1058123448 9:101164693-101164715 CTATCAAAATGTAAGGATCACGG - Intronic
1061806862 9:133141645-133141667 ATGCCGACATGTGAGGAGGAAGG + Intronic
1062578150 9:137218015-137218037 CTTCCAACCTGGAAGGAGGAGGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1191075481 X:56448796-56448818 CTGAAAAAATTTAAGGAGGAAGG - Intergenic
1194777130 X:97978854-97978876 CTGTCAACAGCAAAGCAGGAAGG - Intergenic
1195246266 X:102998377-102998399 CTGCCCATATGTAAGTAGGAAGG - Intergenic
1195611500 X:106872314-106872336 CTGTCAAAAAGAAAGAAGGAAGG + Intronic
1200325923 X:155238896-155238918 ATGTCAACCTGTAAGGATAAAGG - Exonic