ID: 984665777

View in Genome Browser
Species Human (GRCh38)
Location 4:182427584-182427606
Sequence CTATAGCCATAGATAAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984665777 Original CRISPR CTATAGCCATAGATAAAGAT GGG (reversed) Intronic
901651495 1:10745745-10745767 CTATGGCCAGAGATAATGAGTGG - Intronic
903368199 1:22817837-22817859 GCATAGCCATAGCCAAAGATGGG + Intronic
905847462 1:41244355-41244377 CTGTAGCCTTAGATAAGGCTTGG + Intergenic
906361016 1:45159264-45159286 TTATAGCAATAAATAAATATGGG - Intronic
909272566 1:73642810-73642832 CTATAAGCATAGGTAAACATCGG + Intergenic
911405848 1:97438285-97438307 CTTTATCCATAGATAAAAATGGG + Intronic
912071742 1:105818975-105818997 CTATAGTAATAAATACAGATAGG + Intergenic
913195511 1:116453063-116453085 CCAAAACCATAGATATAGATAGG + Intergenic
913478472 1:119261693-119261715 CTGTAACCATAGATGAGGATGGG - Intergenic
918650272 1:186954252-186954274 ATATAGCCATAAAAAAGGATGGG + Intronic
923120111 1:230981990-230982012 CTATAGAGAAAGATAAAGCTGGG - Intronic
923700675 1:236297463-236297485 CTACAGCGAGAGATAAAGATAGG + Intergenic
923814171 1:237357233-237357255 CTATAGCCAAAGAGGAAGGTAGG - Intronic
924426567 1:243956040-243956062 CTATAGCCCAAGATAAAAGTAGG + Intergenic
1068071223 10:52198772-52198794 GTAAAGACAGAGATAAAGATTGG - Intronic
1069541233 10:69295617-69295639 CTGTAGCCTTAGAGAAAGACAGG - Exonic
1071080559 10:81805100-81805122 ATATAGCCTTAGATAAGGCTTGG - Intergenic
1071185466 10:83039062-83039084 CTATAGGAAGAGATAAAGACAGG + Intergenic
1075277974 10:121112513-121112535 TGATAGCCATAGATCAAGAAAGG + Intergenic
1081640532 11:44750323-44750345 TCATAGCCATAGATAAAGGCTGG + Intronic
1082275656 11:50218522-50218544 ATATATTAATAGATAAAGATGGG - Intergenic
1086028128 11:82319563-82319585 CTATGGCCATAGGTAAAATTAGG + Intergenic
1087492627 11:98847324-98847346 CTAAAGCCATAGAAAAAGCAGGG - Intergenic
1088076516 11:105855799-105855821 CTATAACCAGAGAGAAAAATGGG + Intronic
1093204991 12:16238051-16238073 CTATTACAATAAATAAAGATGGG + Intronic
1093291239 12:17324729-17324751 TTATAACCAGAGAGAAAGATCGG + Intergenic
1093557639 12:20495575-20495597 TAATAGCCATAGAAAAAAATTGG - Intronic
1096293469 12:50362438-50362460 CTATAGACAAAAATAAAGAAAGG + Intronic
1096803087 12:54124456-54124478 CTAGAGCCAGAGATCAATATGGG + Intergenic
1098450943 12:70617556-70617578 CTGTAGCCAGAACTAAAGATGGG - Intronic
1099646197 12:85359809-85359831 CAATGTCCATAAATAAAGATTGG - Intergenic
1101559400 12:105841689-105841711 GGATAGCCATAGTTAAAGTTTGG + Intergenic
1101661704 12:106771918-106771940 CTCTATCCATAGATATATATAGG + Intronic
1103831930 12:123787236-123787258 CTATATCCATCTATACAGATAGG + Intronic
1105676999 13:22682364-22682386 CCATAGCCATAGAGTAAGAATGG - Intergenic
1106095688 13:26641091-26641113 CTCTAGGCATAGCTAAAGGTAGG - Intronic
1107214765 13:37903366-37903388 CTATAGCAATGGATAAAGTAAGG + Intergenic
1110491365 13:76112366-76112388 AGATAGCCAGAGATAAAGACAGG + Intergenic
1113088727 13:106595087-106595109 CTTTCGCCATAGATATAAATGGG - Intergenic
1113412031 13:110098720-110098742 ATATAAACATAGATAAAGACAGG + Intergenic
1116376314 14:44206662-44206684 CTATAACCAGAGGTAAAGAATGG - Intergenic
1116739688 14:48738580-48738602 CTATGGCCATAAATTAAAATGGG + Intergenic
1117474500 14:56080369-56080391 TTATTGCAGTAGATAAAGATTGG - Intergenic
1123878011 15:24643709-24643731 CTATATATATAGATATAGATAGG - Intergenic
1124232654 15:27958811-27958833 CTATAGCAAGAATTAAAGATAGG + Intronic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1126639432 15:50810202-50810224 ATATAGTCATAGTTTAAGATAGG - Intergenic
1127405727 15:58643575-58643597 CTATAGCCATAGTTATTGAAGGG + Intronic
1128684413 15:69672989-69673011 CTAAAGCCACAGATAATGACAGG - Intergenic
1129650576 15:77484688-77484710 TTATAGCAATAGATAATAATGGG - Exonic
1131037527 15:89233372-89233394 GTATAGCCTTAGAAAAATATGGG - Intergenic
1132574091 16:656792-656814 CTAAAGCCACAGAAAAAGGTTGG - Exonic
1138801934 16:60043306-60043328 GCATAGCCATAGACAAATATAGG - Intergenic
1140573150 16:76132042-76132064 CTTTATCCATAGAAATAGATTGG + Intergenic
1144184968 17:12788775-12788797 CTCTATCCTTAGAAAAAGATAGG - Intergenic
1145711180 17:26979925-26979947 CTATGGCCAGAGATAAGAATAGG + Intergenic
1147916966 17:43893869-43893891 GTATAGATATAGATAGAGATAGG - Intronic
1150529647 17:65963651-65963673 ATATAGATATAGATATAGATAGG + Intronic
1150542486 17:66117315-66117337 TTATAGCTATAGCTAACGATGGG - Intronic
1155013209 18:21804202-21804224 CCATAGTCCTAGGTAAAGATAGG + Intronic
1155109179 18:22697076-22697098 CTGTTGCCAGAGAAAAAGATGGG - Intergenic
1156753280 18:40487389-40487411 AGATAGAGATAGATAAAGATAGG - Intergenic
1156822251 18:41387126-41387148 ACATAGCCATTTATAAAGATGGG + Intergenic
1159608726 18:70502409-70502431 CTATAGACATAGAAAAAAACTGG - Intergenic
1165720829 19:38078655-38078677 CAATAGCCATTGATCAAGAACGG + Intronic
1166026711 19:40092428-40092450 CTATTACCAGAGATAAAGAAGGG + Intergenic
926539231 2:14154127-14154149 CTTTATCCAGAGATAAAGAGTGG + Intergenic
932162704 2:69476715-69476737 CAATAGAGATAGATAGAGATAGG - Intronic
932956281 2:76355247-76355269 CTGTAGCCATATATAAAGGAAGG - Intergenic
936828257 2:116607840-116607862 CTAGAGTCATAGATAAATCTAGG - Intergenic
939043227 2:137217323-137217345 CTAAAGCCATTAATAGAGATTGG + Intronic
940949046 2:159651455-159651477 CTACTGCCAAAGATTAAGATTGG - Intergenic
941245609 2:163092212-163092234 CTGTAGCTATAGATACATATAGG - Intergenic
944873349 2:203935943-203935965 CTATATTCATATATAAAAATAGG + Intergenic
1168747471 20:256064-256086 ATATATCCATAGATAGAGAGAGG + Intergenic
1169918462 20:10707098-10707120 CTATAACCATAAAAAAAGGTTGG - Intergenic
1170305800 20:14936473-14936495 TTATAGGCATATATAAAGATGGG - Intronic
1171793677 20:29550131-29550153 CTAGAGCCAGAGATCAATATGGG - Intergenic
1172345253 20:34193085-34193107 CTATACAGATAGATAAAGAGAGG - Intergenic
1173249647 20:41357810-41357832 CTAAAGCCAGAGAAACAGATGGG + Intronic
1175637027 20:60593282-60593304 ATATAGACATAGATATAGAAGGG - Intergenic
1178617222 21:34144817-34144839 GTAGAGCCATAGACAAAGACAGG + Intergenic
1178814256 21:35913065-35913087 CTATTTCCAGAGGTAAAGATGGG + Intronic
1179235829 21:39544862-39544884 CAATAGCCTTAGAAAAAGACTGG - Intergenic
1180571310 22:16723719-16723741 CTATAGACAAAGAGAAATATGGG - Intergenic
1182551616 22:31103881-31103903 ACCTATCCATAGATAAAGATTGG + Intronic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
950196354 3:11011790-11011812 TTAAAGCCATTGATAAAAATGGG - Intronic
950298543 3:11853285-11853307 CTATAGCCTAAGAGAGAGATTGG + Intergenic
951098155 3:18655515-18655537 CTAATGCCATACATCAAGATTGG - Intergenic
952731561 3:36642163-36642185 CTCTAGCCTTAGAAAAACATGGG - Intergenic
955396099 3:58558776-58558798 CTATGTTTATAGATAAAGATTGG + Intergenic
955931792 3:64064872-64064894 CTATTGGCATAGAGAAAGATAGG - Intergenic
955983193 3:64547489-64547511 CTATAGCCAGGGAGAGAGATAGG - Intronic
956271674 3:67454510-67454532 CTATAGAGATAGATATAGAGAGG - Intronic
957116630 3:76035151-76035173 GTCCAGCCATAGAAAAAGATAGG - Intronic
957289954 3:78267103-78267125 CTAAAGTCAAAGATAAAGAAAGG - Intergenic
957437012 3:80190600-80190622 TTAAAACCATAGATAAATATAGG + Intergenic
958436277 3:94099677-94099699 CTATAGGCAGAGAAAATGATCGG + Intronic
960431344 3:117572324-117572346 TTTTAGCCATGGATAAAGATGGG + Intergenic
962068074 3:132004202-132004224 ATATAGACATAGATATAGAATGG - Intronic
964614488 3:158648277-158648299 CTTTAACCATAGTTATAGATGGG + Intronic
964935912 3:162086912-162086934 CAATAGCCACAAATAAAGATAGG - Intergenic
965116234 3:164492771-164492793 CTATAGAAATCGATCAAGATTGG + Intergenic
965526927 3:169730600-169730622 CAAAAGCCAAAGATAAAGAAAGG - Intergenic
967636788 3:191810530-191810552 CAAAGGCCAAAGATAAAGATAGG + Intergenic
967669269 3:192213061-192213083 CTGTAGACATTGATAAAGATTGG - Intronic
969237640 4:5877222-5877244 CTATTGCCATAAATAAATATTGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
972678187 4:41280346-41280368 CTATTAGCATAGATAAAGAAAGG - Intergenic
972954524 4:44372894-44372916 CTAAAGCCATTGATACAGCTGGG - Intronic
974856572 4:67468054-67468076 CTATATCTATAGATATATATAGG - Intergenic
977140469 4:93365259-93365281 CTATTGACAAAAATAAAGATTGG - Intronic
977327214 4:95590888-95590910 CTATAGTCATAGAAACAAATGGG + Intergenic
978285983 4:107077125-107077147 CTTTAGCCCTAGATAAAACTGGG + Intronic
980654086 4:135759514-135759536 CTCTAGCCATAGCTAAAAAGGGG - Intergenic
982648928 4:158062377-158062399 TTGCAGGCATAGATAAAGATGGG - Intergenic
984665777 4:182427584-182427606 CTATAGCCATAGATAAAGATGGG - Intronic
984817179 4:183849684-183849706 CTACAGCCAGAAATAAAGACTGG + Intergenic
988980636 5:36564661-36564683 ATATACCCGTATATAAAGATGGG + Intergenic
989127922 5:38074816-38074838 GTATGGCCATAGACAAATATCGG - Intergenic
990101660 5:52197769-52197791 CTATAGACATAGATCCAGACTGG - Intergenic
992468019 5:77026447-77026469 CTAGGCCCATATATAAAGATGGG + Intergenic
998109551 5:139490595-139490617 CTTTAGCCATTGATATAGTTTGG + Intergenic
999369993 5:151048946-151048968 CTATGGCCATAGCTATAGAATGG + Intronic
1000819141 5:165961416-165961438 CTATAGCCATAGCCATAGATGGG - Intergenic
1001094962 5:168768914-168768936 CTCTAGCCAGAGAGAAAGACAGG + Intronic
1008413309 6:51208726-51208748 GTATATACATAGAAAAAGATTGG + Intergenic
1009674746 6:66803955-66803977 CTATAACCAAAGTTAGAGATGGG - Intergenic
1012103855 6:95127889-95127911 GTATAGCCATAAATAAACAATGG - Intergenic
1012291632 6:97462964-97462986 CTAAAGTGATAGATAAATATAGG + Intergenic
1012308844 6:97695483-97695505 TTATAGACATATATAAATATGGG - Intergenic
1012383941 6:98655109-98655131 CTATTGGCCTAGATAAAGGTAGG + Intergenic
1012507732 6:99968353-99968375 CAATATCAATATATAAAGATGGG - Intronic
1014600542 6:123406644-123406666 TGATAGCCATATATAAACATAGG + Intronic
1015166641 6:130206700-130206722 TTATGACCAGAGATAAAGATAGG + Intronic
1018123394 6:160658944-160658966 CTATATCTATAGATAGATATAGG - Intronic
1021127989 7:16876268-16876290 ATATAGCCAGAGATAGAGATAGG - Intronic
1023526883 7:41113769-41113791 ATTTAGGCCTAGATAAAGATGGG - Intergenic
1024131666 7:46359129-46359151 CTATTGCAATAGGTAAAGAATGG + Intergenic
1024435099 7:49342676-49342698 GTATAACTATGGATAAAGATGGG - Intergenic
1025621594 7:63176861-63176883 TTATACACATACATAAAGATGGG - Intergenic
1026429965 7:70335445-70335467 GTATGGCCATGGACAAAGATGGG - Intronic
1026693198 7:72567902-72567924 CCATAGCCATAAAAAAAGAATGG - Intronic
1027621171 7:80487332-80487354 CTGTAGCCAGAGAGATAGATTGG + Intronic
1030590838 7:111479435-111479457 ATAGAGGCATACATAAAGATAGG - Intronic
1031326674 7:120408399-120408421 TTATAGCTAGAGGTAAAGATTGG + Intronic
1032775920 7:135112577-135112599 TTATAGCCATACTTATAGATGGG - Intronic
1035777228 8:2197418-2197440 AGATAGCTATAGATACAGATAGG - Intergenic
1035777229 8:2197456-2197478 GTATAGATATAGATACAGATAGG - Intergenic
1035777233 8:2197563-2197585 ATATAGATATAGATACAGATAGG - Intergenic
1035877784 8:3210777-3210799 CTTTAGCCATAGAAAAAGCATGG - Intronic
1039909633 8:41814622-41814644 AAATAGCCATGGTTAAAGATCGG + Intronic
1041442356 8:57911127-57911149 CTACAGCCACAGATCAGGATAGG + Intergenic
1042544210 8:69936373-69936395 ATATGGCCATAGAAAAATATTGG - Intergenic
1044675920 8:94728441-94728463 CTATAACCATATCTAAAGATGGG + Intronic
1045369546 8:101508788-101508810 CTATAGCCAGACACAAAGCTGGG + Intronic
1046357630 8:113108862-113108884 CTAAAGCCATAGATTAATTTGGG - Intronic
1050069251 9:1793112-1793134 CTAGGGCCAAAGATAAAGAAGGG - Intergenic
1052088197 9:24293430-24293452 CTGTAGCAATTGACAAAGATGGG - Intergenic
1052978695 9:34431111-34431133 CTGCAGCCATAGAGAGAGATTGG - Intronic
1053792617 9:41697540-41697562 CTAGAGCCAGAGATCAATATGGG + Intergenic
1054181031 9:61909561-61909583 CTAGAGCCAGAGATCAATATGGG + Intergenic
1054472334 9:65548428-65548450 CTAGAGCCAGAGATCAATATGGG - Intergenic
1054656560 9:67671581-67671603 CTAGAGCCAGAGATCAATATGGG - Intergenic
1055870696 9:80875896-80875918 CTAAAGCAATAGATGAAGAAAGG + Intergenic
1057723313 9:97550079-97550101 GTAAATCCATAGATACAGATTGG - Intronic
1057811829 9:98263368-98263390 CTATACACATAAATAAATATGGG + Intergenic
1058204265 9:102083592-102083614 CCATAGCCTTAGGTAAACATGGG - Intergenic
1186048839 X:5567161-5567183 CTATAGCCATGCATGAAAATTGG - Intergenic
1187029527 X:15471452-15471474 CTATAGCTAGAGATCAAGCTTGG + Intronic
1188502180 X:30839526-30839548 CTAGCGCCATAAAAAAAGATGGG + Intronic
1191997589 X:67113053-67113075 CTATACCCAAGGATAGAGATGGG + Intergenic
1193350667 X:80461015-80461037 CTATATCTATAGATATAAATTGG + Intergenic
1195652045 X:107295169-107295191 CTTTAGGCATAGAACAAGATTGG - Intergenic
1195894477 X:109732394-109732416 CTATAGACATAGAAAAATCTAGG - Intronic
1196034318 X:111127054-111127076 ATATAGCCATAGAAAAAGACTGG - Intronic
1199405015 X:147446455-147446477 CAAAAGCTATAAATAAAGATAGG - Intergenic