ID: 984667840

View in Genome Browser
Species Human (GRCh38)
Location 4:182448263-182448285
Sequence CCGCGCTCGCCCCTGGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984667840_984667848 29 Left 984667840 4:182448263-182448285 CCGAGGCCCAGGGGCGAGCGCGG 0: 1
1: 1
2: 0
3: 25
4: 205
Right 984667848 4:182448315-182448337 CGACACCCACCCCTTCGCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984667840 Original CRISPR CCGCGCTCGCCCCTGGGCCT CGG (reversed) Intronic
900494990 1:2972234-2972256 CTGTGCTCGCCCTTGGGCCTGGG - Intergenic
900584905 1:3428089-3428111 CCGCACACGCTCCTGGTCCTGGG - Intronic
901004865 1:6166733-6166755 CTGCCTTCGCCTCTGGGCCTCGG - Intronic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
904029285 1:27523938-27523960 CAGAGCTCGCCCCTGTGCCCAGG - Intergenic
905626221 1:39491933-39491955 CCGCCGCCGCCCCTGGGCCCGGG - Exonic
905670681 1:39788535-39788557 CCGCGGCCGACCCAGGGCCTGGG + Exonic
908293125 1:62688001-62688023 CCGCGCCCGCCGCTGAGCCTCGG - Intronic
908551041 1:65208907-65208929 CAGTGCTGGCCACTGGGCCTTGG - Intronic
908557005 1:65266003-65266025 CGGCGCTTGCCCCTTGGGCTCGG + Intronic
911647466 1:100352231-100352253 CCGCCCGCTCCCCTGGGCCGAGG + Intronic
912401579 1:109397837-109397859 TCGCGCTGGCCCCATGGCCTCGG - Exonic
914386160 1:147172227-147172249 CCGGCCCCGCCCCTGCGCCTCGG + Intronic
921024045 1:211260543-211260565 CCTCGCTCGCCCCGGCGCCGAGG + Intronic
921185398 1:212665587-212665609 CCTAGCCCGCCCTTGGGCCTAGG - Intergenic
924527116 1:244863200-244863222 GCGCGCCCGCCCCGGGACCTGGG + Intronic
924707108 1:246510239-246510261 CCCCTCACGCCCCTGGGCCTTGG + Intergenic
1062958837 10:1558045-1558067 CCACGCTCACTGCTGGGCCTGGG - Intronic
1065215046 10:23440078-23440100 CCGGGGTCGCCGCGGGGCCTCGG - Exonic
1069486760 10:68828326-68828348 CCGCGCTCGCCCCTGCAGCGCGG - Intronic
1070799053 10:79234309-79234331 CCACGCCCTTCCCTGGGCCTCGG + Intronic
1071544957 10:86521958-86521980 CCGCTCCCGCGCCTGGTCCTCGG - Intergenic
1072656472 10:97333928-97333950 CCGCAAGCGCCCCTGGGCCCGGG - Exonic
1072891647 10:99329860-99329882 CCGCACTCGCACCTGGACCAGGG - Exonic
1073336481 10:102714196-102714218 CAGTGCTCCGCCCTGGGCCTGGG + Intronic
1073353352 10:102835224-102835246 CCAGGCTGGCCCCTGGGGCTGGG - Intronic
1075070931 10:119319433-119319455 CCCTGATCGGCCCTGGGCCTCGG + Intronic
1075420156 10:122294724-122294746 CCGGGCTCGCCTCTGGGCTCAGG - Intronic
1076364871 10:129915263-129915285 CCGGGCTGGGCCCTGGGTCTTGG - Intronic
1076558932 10:131348404-131348426 CTGCCCTCGCCCCGGGACCTGGG - Intergenic
1077096177 11:800073-800095 CCCTGGTCACCCCTGGGCCTCGG + Intronic
1077413703 11:2414879-2414901 CCGCGCTGGGCCCGCGGCCTGGG + Intronic
1079035060 11:17013949-17013971 CCGCGCTCGCACCTGTGCCGCGG - Intronic
1081632737 11:44700818-44700840 GCGCTCCCTCCCCTGGGCCTGGG - Intergenic
1081705713 11:45181033-45181055 CGGCGCTGGGCCCTGGGACTGGG - Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081807740 11:45899630-45899652 CCCCGCTCGCCCCTCCCCCTCGG + Intronic
1084313664 11:68331430-68331452 CCCCGCCTGCCCCAGGGCCTTGG + Intronic
1084527246 11:69704823-69704845 CCGCGCTCGCCCCGGCCCCGCGG + Intergenic
1084603382 11:70159581-70159603 CCCCACACGCCCCTGGTCCTGGG + Intronic
1087118111 11:94544986-94545008 CAGCGCTGGCCCGGGGGCCTGGG - Exonic
1090803728 11:130189903-130189925 CCACGCCCACCCCTGGCCCTCGG - Intronic
1095440880 12:42238048-42238070 CCGTGCTCGCCCCGGTGCCCGGG + Intronic
1096226259 12:49868594-49868616 TCACGCTTGCCCCTGGGCCTGGG - Exonic
1096237460 12:49939561-49939583 CAGCCCTGGGCCCTGGGCCTAGG + Intergenic
1096241320 12:49961769-49961791 CCGCGCTGGCCCCCGAGCGTAGG + Intergenic
1102113817 12:110385444-110385466 TCCTGCTAGCCCCTGGGCCTGGG + Intronic
1103364006 12:120369315-120369337 CCGCGCTCGCCCGCGAGCCCGGG + Intergenic
1104185886 12:126430882-126430904 ACGCACTCACCCCAGGGCCTTGG + Intergenic
1104459690 12:128945228-128945250 CCGCGCTGGCACCAGGGCTTTGG + Intronic
1104640191 12:130462208-130462230 CCTCACTTGCTCCTGGGCCTGGG + Intronic
1104901373 12:132191071-132191093 CCGGGCTGGCACCTGGGCCTTGG + Intergenic
1104966377 12:132510333-132510355 CGGCTCTCGCTCCTGGCCCTGGG + Intronic
1104975858 12:132551720-132551742 CCGCCCCCTCCCCTGGCCCTTGG + Intronic
1105705592 13:22965860-22965882 CCTCACTGGCCCCTGGGGCTGGG + Intergenic
1105767951 13:23579467-23579489 CTCCGCGCGCCCCTGAGCCTCGG + Exonic
1105858496 13:24390845-24390867 CCTCACTGGCCCCTGGGTCTGGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1118339195 14:64880154-64880176 CCCCGCCCGCCGCTGAGCCTGGG + Intergenic
1118873942 14:69767066-69767088 CCGGGGACGCCCCTGGGCCTTGG - Exonic
1119214662 14:72859568-72859590 CCGCTCTGTCCCCTGGGCCAGGG - Intronic
1119338127 14:73851858-73851880 CCCAGCTCGCCCCCAGGCCTCGG - Exonic
1119421292 14:74509375-74509397 CAGCGCTCGCCCGGGGACCTAGG + Intronic
1121103446 14:91265041-91265063 ACGGGCTTGCCCCCGGGCCTGGG + Intergenic
1121216307 14:92251096-92251118 CTGGGCTCGCCCCTGGGCAGTGG - Intergenic
1122815052 14:104308074-104308096 CCGAGCTCTCCCCCGGGGCTCGG + Intergenic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1127142728 15:55993749-55993771 CGGCGCGCGCTCCTGGGGCTGGG + Intergenic
1128743946 15:70100754-70100776 CCGGGCTCGGCCCTGGCGCTGGG - Intergenic
1129241064 15:74252578-74252600 CCACATTCTCCCCTGGGCCTTGG - Intronic
1129367107 15:75062916-75062938 ACCTGCTCGCACCTGGGCCTGGG + Intronic
1129670815 15:77606790-77606812 CCGCCCCCGCCCCTGGGAATGGG + Intergenic
1129741584 15:77992188-77992210 CCTCCCTCCCCACTGGGCCTGGG + Intronic
1130257742 15:82333609-82333631 CCTCCCTCCCCACTGGGCCTGGG + Intergenic
1130597194 15:85256354-85256376 CCTCCCTCCCCACTGGGCCTGGG - Intergenic
1130989835 15:88869721-88869743 CCCAGCTCGGCCCTGGGCCTGGG + Intronic
1132153270 15:99477093-99477115 CCACGCTCCCGCCTGGGCCCTGG + Intergenic
1132466201 16:78378-78400 CCGCGCTCGCTGCTGCGCCTGGG - Intronic
1132901246 16:2255671-2255693 CCGTGCTGGCCCCCTGGCCTAGG - Exonic
1133100786 16:3478362-3478384 CCACGCTGGACCGTGGGCCTTGG + Intronic
1134137708 16:11690296-11690318 CAGAGCTTGCCCCTGGGACTTGG - Intronic
1134615858 16:15650551-15650573 TCGCGCTGGCCCCTCGCCCTTGG + Intronic
1135335830 16:21599997-21600019 CGGCCCTCGCCCCTCCGCCTCGG + Intronic
1135753471 16:25076247-25076269 CCGCGATAGTCCCTGGGCCTAGG - Intergenic
1136417898 16:30114522-30114544 CCGCCCTCCCCACGGGGCCTCGG - Exonic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138651487 16:58463809-58463831 GCGCCCTCGCCCCTGAGCCCAGG + Intronic
1139779537 16:69339424-69339446 CCGCTCGCGCCACTGGGCCTCGG + Exonic
1141452718 16:84116629-84116651 CAGCCCTCGCCTCGGGGCCTCGG + Intronic
1141792049 16:86243560-86243582 CTGCGCTCCTCACTGGGCCTGGG - Intergenic
1142156205 16:88533861-88533883 CCGCGCTCGTCCCCGGGCCCCGG + Exonic
1144726276 17:17504206-17504228 GCCCCCTCGCCCCTGGACCTGGG - Intergenic
1144756156 17:17681763-17681785 CCGCGCTCACTCGGGGGCCTTGG - Exonic
1145810157 17:27759622-27759644 CCGCGTTACCCCCTGAGCCTGGG - Intronic
1145964360 17:28906435-28906457 CCGCTGCGGCCCCTGGGCCTGGG + Exonic
1147159357 17:38561519-38561541 CGGAGCTCTTCCCTGGGCCTGGG - Exonic
1148262043 17:46192904-46192926 CCCCGCCCGCCGCTGGCCCTCGG - Intronic
1152420468 17:80190110-80190132 CCTGGCTCTCCCCGGGGCCTGGG - Intronic
1153480623 18:5543479-5543501 CCGCGCTCGCCCCCAGCCCGAGG + Intronic
1154501079 18:14998342-14998364 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157601099 18:48893706-48893728 CCCTGCTTGCCCCTTGGCCTGGG - Intergenic
1160847787 19:1174030-1174052 CCGCGCTCGCCCCCGCCCCACGG + Intronic
1160983584 19:1827571-1827593 CCGCCCTCGGCCCTTGTCCTTGG + Exonic
1161101629 19:2424592-2424614 CAGCCCTCGCCCCTGGGACTTGG + Intronic
1161226418 19:3148586-3148608 TCCCGCTCTCGCCTGGGCCTGGG - Exonic
1161396037 19:4045427-4045449 CCCCCCTCTCCCCTGGGGCTGGG - Exonic
1161610424 19:5238960-5238982 GCCCGCTCGCCGCAGGGCCTGGG - Exonic
1161713728 19:5864029-5864051 CCACCCTCCCACCTGGGCCTGGG + Intergenic
1162130121 19:8521335-8521357 CAGCCCCCGCCCCTGGGCCCTGG - Exonic
1162966937 19:14160527-14160549 CCCCGCTGGGCCCTGGGCCCTGG + Intronic
1163028730 19:14529503-14529525 CCACGTTCGCCCCTGCTCCTTGG - Intronic
1163748176 19:19060262-19060284 CAGCGTCCTCCCCTGGGCCTGGG + Intronic
1164309072 19:24030544-24030566 CAGCTCTCGACCCTGAGCCTCGG + Intergenic
1165213905 19:34255230-34255252 CTGCGCTCGTCCCTCGGGCTCGG - Intronic
1165838587 19:38773618-38773640 CCGGGCTTGCCCCAGGGCCAGGG - Intergenic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166499714 19:43331536-43331558 CCGCCCCTGCCCCTGGCCCTAGG - Intergenic
1166753728 19:45178125-45178147 CGGCGCTCACCCCCGGGCCGGGG + Exonic
1167266336 19:48484764-48484786 CCCCACTAGCCCCTGGCCCTGGG + Intergenic
1168239527 19:55082187-55082209 ACGCGCCCGCCCCTGGGCCGGGG + Intronic
927059073 2:19397193-19397215 CCGTGCCCACCCCTGGCCCTCGG + Intergenic
927684635 2:25161810-25161832 CCGCGCCCGTCACTGCGCCTAGG + Intronic
927980120 2:27369876-27369898 CGGAGCTTCCCCCTGGGCCTGGG - Exonic
928025378 2:27735383-27735405 CCGGGCTCAGCCCTGGGTCTGGG - Intergenic
928650622 2:33400186-33400208 CCCACCCCGCCCCTGGGCCTTGG + Intergenic
929242450 2:39666242-39666264 TGGCGCTCGCTCCTGGGGCTCGG + Exonic
929452571 2:42047491-42047513 CAGCGCTCCCTCCTGGGACTGGG - Intergenic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
934754657 2:96816674-96816696 CCGCCCTGGGCTCTGGGCCTGGG + Exonic
938381009 2:130836760-130836782 CCCTGCCCGCCCCTGGGCTTTGG - Intergenic
938500247 2:131828531-131828553 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
941917736 2:170823310-170823332 CCGCCCTCGCCCCGGGACCCAGG - Intronic
943383011 2:187173677-187173699 CTGGGCTGGACCCTGGGCCTGGG + Intergenic
947287753 2:228535950-228535972 CCATGCTAGTCCCTGGGCCTTGG - Intergenic
947720683 2:232367789-232367811 CAGCTCCCGCCCCTGGCCCTTGG + Intergenic
949032511 2:241803766-241803788 CCGCGCGCGCTCCCGGGTCTCGG - Exonic
949041031 2:241850089-241850111 CCGGGCTCCCACCAGGGCCTGGG - Exonic
1168997524 20:2144333-2144355 CCTGGCTAGCCCTTGGGCCTCGG + Exonic
1169483371 20:6005899-6005921 CCCCGCCCACCCCCGGGCCTTGG + Intergenic
1169827943 20:9790406-9790428 CCTCGCATTCCCCTGGGCCTTGG - Intronic
1171011328 20:21510870-21510892 CCCCGCCCGCCCCAGGGCCCCGG + Intergenic
1171349280 20:24490521-24490543 CCTGGCTCGCCCCTAGCCCTTGG + Intronic
1171361601 20:24590237-24590259 ACGTGCTCCCCCCAGGGCCTCGG - Intronic
1172714258 20:36951326-36951348 CAGGGCTCGCTCCTCGGCCTCGG + Intronic
1173729417 20:45318070-45318092 CCGTGGTCACCTCTGGGCCTGGG - Intergenic
1175888084 20:62303370-62303392 CCGCACTCGGCGCTGGGCCGGGG - Intronic
1175958894 20:62625158-62625180 CCGAGCTCATCCCTGGGCCTTGG - Intergenic
1179189073 21:39108013-39108035 CAGCACTCGCCCCTGGGGCTGGG - Intergenic
1179724471 21:43334109-43334131 CCCCGCTCGCCCCTGGCCTCCGG - Intergenic
1179827405 21:43973858-43973880 CAGGGCTGGCCCCTGGGCCGAGG + Intronic
1180088944 21:45524100-45524122 GAGCGTTCACCCCTGGGCCTCGG + Intronic
1180088954 21:45524138-45524160 AAGCGTTCACCCCTGGGCCTTGG + Intronic
1180088992 21:45524289-45524311 GAGCGTTCACCCCTGGGCCTTGG + Intronic
1180089034 21:45524441-45524463 AAGCGTTCACCCCTGGGCCTTGG + Intronic
1180089072 21:45524592-45524614 GAGCGTTCACCCCTGGGCCTTGG + Intronic
1180089114 21:45524744-45524766 AAGCGTTCACCCCTGGGCCTTGG + Intronic
1180089143 21:45524857-45524879 AAGCGTTCACCCCTGGGCCTTGG + Intronic
1180609207 22:17084947-17084969 CCCGGCCCGCCCCTGGGCCCGGG + Exonic
1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG + Intronic
1180962168 22:19766964-19766986 CCGCGGTGGCCCCTGGGGCTGGG - Exonic
1181386058 22:22546692-22546714 TAGAGCCCGCCCCTGGGCCTTGG + Intergenic
1181745408 22:24952558-24952580 CCGCAGTGGCGCCTGGGCCTGGG - Intergenic
1181807914 22:25386155-25386177 CCCCGCCTGCCCCAGGGCCTTGG - Intronic
1182124058 22:27803896-27803918 CCCCGCCCGCCCCGGGGCCTAGG + Intergenic
1183273072 22:36874084-36874106 CAGGGCTCGCCCCAGAGCCTGGG + Intronic
1183363133 22:37393333-37393355 CTCCACTCGCACCTGGGCCTGGG + Intronic
1184086626 22:42269895-42269917 CCGCGCTCGCCTCTTGGCTACGG - Intronic
949773308 3:7602549-7602571 CCGTGCTCTCCCCTGTGCCCAGG + Intronic
949947880 3:9204396-9204418 CCCCGCTCACTCCTGGGCCTGGG + Intronic
950345564 3:12288620-12288642 CGGCGGTCGCCCCTGGGCTCTGG - Intronic
950529568 3:13545450-13545472 CTGCCCTCGGGCCTGGGCCTGGG + Intergenic
953099254 3:39809466-39809488 CCGCGATCGCGCCTGCGCCGGGG - Intronic
954133180 3:48570291-48570313 CCACGCTCGCCTCGGGGCCCAGG + Exonic
956825994 3:72997148-72997170 CCGCGCCCGGCCCCGGTCCTCGG - Intronic
958779318 3:98522654-98522676 CCGTGCTCGGCCCCGGGCCAGGG + Intronic
960047487 3:113211962-113211984 CCACGCTGGCCCCCGGGCCCCGG + Exonic
960990277 3:123305717-123305739 CCCTGCTCACCCCTGGGTCTTGG + Intronic
961604106 3:128081165-128081187 GGGCGCTTGCCCCTGGGCTTGGG - Exonic
963061819 3:141232113-141232135 CCGCGCTCGCCCCTGAGCCTAGG + Intronic
963603562 3:147396516-147396538 GCGCGCTCTTCCCTGGGCCCCGG + Intronic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
968652881 4:1767100-1767122 CCGGGCGCGCCTCTGGGCTTGGG - Intergenic
968775519 4:2537248-2537270 CCGCTGTCGGCCCCGGGCCTGGG + Intronic
969868631 4:10091570-10091592 CTGCGCTGGCTCCTGGGCCTTGG + Intronic
972675690 4:41257497-41257519 CCGCGCCCGCACCCGAGCCTGGG - Intronic
976751841 4:88457231-88457253 CTCCTCTCGCCTCTGGGCCTGGG + Exonic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
997521700 5:134527487-134527509 CCCCACCCGCCCCTGGGGCTCGG + Intronic
998199589 5:140108540-140108562 CCGCCTTCGCCCTGGGGCCTGGG + Intronic
998413035 5:141925419-141925441 CCCCGCTCGTGCCTGGGCCATGG - Exonic
999727270 5:154446816-154446838 CCCCGCTCGCGTCTGGGCCCCGG + Intronic
1000345684 5:160312039-160312061 CCTCTCTCGCCCCTGGCCCCGGG + Intronic
1001315560 5:170638921-170638943 CCGGCCTCTCCCCTAGGCCTGGG - Intronic
1004615057 6:17281456-17281478 CCGGGCTCGCCCTTGGCCCCCGG + Exonic
1005968438 6:30743082-30743104 CCGCGCACCTCCCTGGGCCCAGG - Intergenic
1007631434 6:43275430-43275452 CCGCCCCCGCCCCGGGGCCAGGG - Intronic
1020086812 7:5315009-5315031 CCGCCCACGCCCACGGGCCTTGG + Exonic
1020389539 7:7643418-7643440 CCGCGCCCGGCCCTGATCCTAGG - Intronic
1025004705 7:55344799-55344821 CCGCGCTCTCCCCAGCGCCTGGG + Intergenic
1026033720 7:66816260-66816282 CAGCCCTCCCCTCTGGGCCTCGG + Intergenic
1026057208 7:66995256-66995278 CCTCCCTCGGGCCTGGGCCTGGG - Intronic
1026551406 7:71372199-71372221 CTGCACTCGGGCCTGGGCCTGGG - Intronic
1026720905 7:72829795-72829817 CCTCCCTCGGGCCTGGGCCTGGG + Intergenic
1029972287 7:104801272-104801294 CTGGGCTGGTCCCTGGGCCTGGG - Intronic
1031134826 7:117873308-117873330 CCGCGCCCGCCCCGGGAACTCGG + Intronic
1032094517 7:128931304-128931326 CCGCTCCCTCCCCTGGGCCTGGG - Intergenic
1032174413 7:129611928-129611950 CCGCCCCCGGCTCTGGGCCTGGG + Intronic
1033256399 7:139805382-139805404 CCTCACTTGCTCCTGGGCCTGGG + Intronic
1033662015 7:143408777-143408799 CGGCGCTGGCCCCTGGGGCTAGG - Exonic
1034178085 7:149116079-149116101 CCCTGCTGGCTCCTGGGCCTCGG + Intronic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035153206 7:156892622-156892644 CCGCCCCCGCCCCGCGGCCTCGG - Intronic
1038416881 8:27403457-27403479 AAGCGCTGGCCCCTGTGCCTAGG + Intronic
1038450132 8:27634254-27634276 CCCCGCTCCACCCAGGGCCTGGG + Intronic
1038481622 8:27905745-27905767 CTGCACTCCCGCCTGGGCCTGGG - Intronic
1040564891 8:48556349-48556371 CCGTGCTGGCCCCTGGCGCTAGG - Intergenic
1041107537 8:54457916-54457938 CTGCGGGCGCCCCTGGGCCGCGG - Exonic
1056960520 9:91118326-91118348 ACGCGGGCGCGCCTGGGCCTTGG + Intergenic
1057054566 9:91950384-91950406 CCGCCCTCGGGCCTGCGCCTCGG + Intergenic
1057193242 9:93098859-93098881 CAGCCCTTGCCCCTGGGTCTTGG + Intronic
1057220753 9:93256504-93256526 CTGTGCTGGCCCCTGGGCCCAGG + Intronic
1057631099 9:96719811-96719833 CCGCGCTCTCCCCTGGGGCGCGG - Intergenic
1058437769 9:104979044-104979066 AGGCGCCCGCCACTGGGCCTAGG - Intergenic
1061261602 9:129483364-129483386 CCACGCCCGGCCCTGGGGCTGGG - Intergenic
1061947764 9:133918373-133918395 CCGGGCTAGCAGCTGGGCCTGGG - Intronic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1203779430 EBV:92698-92720 CCATTCTCGCCCGTGGGCCTTGG + Intergenic
1188862759 X:35276300-35276322 CCCCGCTCCCTGCTGGGCCTGGG - Intergenic
1189002839 X:36963857-36963879 CCCAGCGCGCCCCTGTGCCTCGG - Intergenic
1193328465 X:80209057-80209079 CCACGATAGTCCCTGGGCCTAGG + Intergenic
1200155726 X:153973952-153973974 CAGCACTGGCCCCTGGGTCTGGG - Intronic