ID: 984671688

View in Genome Browser
Species Human (GRCh38)
Location 4:182496765-182496787
Sequence CTGTAAGGACAAATTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984671684_984671688 12 Left 984671684 4:182496730-182496752 CCTGCTGAGTGTGCTTTACGATT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG No data
984671683_984671688 25 Left 984671683 4:182496717-182496739 CCATAGAACAGCTCCTGCTGAGT 0: 1
1: 0
2: 0
3: 7
4: 147
Right 984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984671688 Original CRISPR CTGTAAGGACAAATTGAGGC TGG Intronic
No off target data available for this crispr