ID: 984674317

View in Genome Browser
Species Human (GRCh38)
Location 4:182529524-182529546
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5014
Summary {0: 1, 1: 4, 2: 57, 3: 585, 4: 4367}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984674317_984674322 23 Left 984674317 4:182529524-182529546 CCATTTCATTCTTCTTCCTTTCT 0: 1
1: 4
2: 57
3: 585
4: 4367
Right 984674322 4:182529570-182529592 ACTCCACCCCATTTGGTTCAGGG No data
984674317_984674323 24 Left 984674317 4:182529524-182529546 CCATTTCATTCTTCTTCCTTTCT 0: 1
1: 4
2: 57
3: 585
4: 4367
Right 984674323 4:182529571-182529593 CTCCACCCCATTTGGTTCAGGGG No data
984674317_984674319 16 Left 984674317 4:182529524-182529546 CCATTTCATTCTTCTTCCTTTCT 0: 1
1: 4
2: 57
3: 585
4: 4367
Right 984674319 4:182529563-182529585 TTTTTCCACTCCACCCCATTTGG No data
984674317_984674321 22 Left 984674317 4:182529524-182529546 CCATTTCATTCTTCTTCCTTTCT 0: 1
1: 4
2: 57
3: 585
4: 4367
Right 984674321 4:182529569-182529591 CACTCCACCCCATTTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984674317 Original CRISPR AGAAAGGAAGAAGAATGAAA TGG (reversed) Intronic