ID: 984674318

View in Genome Browser
Species Human (GRCh38)
Location 4:182529540-182529562
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984674318_984674322 7 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT No data
Right 984674322 4:182529570-182529592 ACTCCACCCCATTTGGTTCAGGG No data
984674318_984674328 26 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT No data
Right 984674328 4:182529589-182529611 AGGGGCCTAGATAGTACTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 55
984674318_984674321 6 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT No data
Right 984674321 4:182529569-182529591 CACTCCACCCCATTTGGTTCAGG No data
984674318_984674323 8 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT No data
Right 984674323 4:182529571-182529593 CTCCACCCCATTTGGTTCAGGGG No data
984674318_984674319 0 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT No data
Right 984674319 4:182529563-182529585 TTTTTCCACTCCACCCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984674318 Original CRISPR ATTTATACTACGTAGAAGAA AGG (reversed) Intronic