ID: 984674318

View in Genome Browser
Species Human (GRCh38)
Location 4:182529540-182529562
Sequence ATTTATACTACGTAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984674318_984674323 8 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 984674323 4:182529571-182529593 CTCCACCCCATTTGGTTCAGGGG No data
984674318_984674321 6 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 984674321 4:182529569-182529591 CACTCCACCCCATTTGGTTCAGG No data
984674318_984674322 7 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 984674322 4:182529570-182529592 ACTCCACCCCATTTGGTTCAGGG No data
984674318_984674328 26 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 984674328 4:182529589-182529611 AGGGGCCTAGATAGTACTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 55
984674318_984674319 0 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 984674319 4:182529563-182529585 TTTTTCCACTCCACCCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984674318 Original CRISPR ATTTATACTACGTAGAAGAA AGG (reversed) Intronic
901909764 1:12446833-12446855 ATTTATACTAGGAAGAAAGATGG - Intronic
905333524 1:37226821-37226843 ATTTAGACTAGGTAAAAGAATGG - Intergenic
906755032 1:48303756-48303778 GGTTATACTACCTAAAAGAAAGG - Intronic
910917945 1:92311396-92311418 ACTTATACTACCTTGTAGAAAGG + Intronic
911821412 1:102428370-102428392 ATTTAGAATAAGTAAAAGAATGG + Intergenic
912484480 1:110014263-110014285 ATTTATGTAAAGTAGAAGAAAGG - Intronic
913008115 1:114655093-114655115 AGTTCTATTACTTAGAAGAATGG + Intronic
914255478 1:145958697-145958719 ACTTATTCTAAGTAGAGGAAGGG + Intergenic
916235081 1:162578840-162578862 ATGTAAACTACATATAAGAAGGG - Intronic
916900816 1:169221041-169221063 ATTTCTACTCCGTAGAACTAAGG + Intronic
918857400 1:189775860-189775882 ATTTATTCTACCTATAAGTAGGG - Intergenic
918999259 1:191808138-191808160 ATATAAACTACTTAGAACAACGG + Intergenic
923513233 1:234671788-234671810 AATTTTACTACTTAGAGGAAAGG - Intergenic
1063807226 10:9659457-9659479 ATTCCAACTACATAGAAGAAAGG + Intergenic
1064890348 10:20164561-20164583 ATTCCCAGTACGTAGAAGAAGGG + Exonic
1066597142 10:37063396-37063418 CTTTATACTATGTGGAAGATCGG - Intergenic
1068115937 10:52737719-52737741 AATTAAAATAAGTAGAAGAAAGG + Intergenic
1070399670 10:76042272-76042294 ATTTATAGTAGGTAGTTGAAAGG + Intronic
1071820571 10:89276010-89276032 AATTATACTATGGAGTAGAAAGG - Intronic
1072623178 10:97094128-97094150 CTGTGTCCTACGTAGAAGAAAGG + Intronic
1078283494 11:9926860-9926882 ATATAAAGTAAGTAGAAGAAAGG + Intronic
1079086801 11:17451906-17451928 ATTTAAACTAGCCAGAAGAAGGG - Intronic
1080037573 11:27724878-27724900 ATTAATACAACCTAGAAGGAAGG + Intergenic
1087117497 11:94541392-94541414 ATTTTTATTACGTATAAGGAGGG - Intergenic
1088060962 11:105649557-105649579 AGTTATACAACAAAGAAGAAAGG - Intronic
1089301802 11:117503426-117503448 ATATACACAATGTAGAAGAAGGG - Intronic
1089538621 11:119175738-119175760 ATTTATACTAGGAAGATAAATGG + Intronic
1093527858 12:20123957-20123979 ATTTAGACCAGGCAGAAGAATGG - Intergenic
1094150083 12:27273209-27273231 ATTTATTTTATGGAGAAGAATGG + Intronic
1094517651 12:31148873-31148895 AATTATACTACGGACGAGAATGG - Intergenic
1094748797 12:33380611-33380633 ATTTAAACTACCTAGAACACTGG - Intronic
1095787744 12:46128706-46128728 ATCTATAAGAGGTAGAAGAATGG - Intergenic
1096173094 12:49490016-49490038 TTATCTAATACGTAGAAGAATGG + Intronic
1096849440 12:54426334-54426356 ATATATACTACTTAGATCAATGG - Intergenic
1097366609 12:58721370-58721392 ATTTTTCCTACTTAGAAAAATGG - Intronic
1098218934 12:68247577-68247599 ATTTGTTCTACCAAGAAGAATGG - Intergenic
1098783959 12:74725317-74725339 ATGTGTACTGCATAGAAGAAAGG + Intergenic
1100962597 12:99979872-99979894 ATTTATACTAAGTTGAAGAGAGG + Intronic
1105045272 12:132998008-132998030 ATTTATTCTTGGTAGAAGTAGGG - Intronic
1107132150 13:36908045-36908067 ATTGGCACTAAGTAGAAGAAAGG - Intronic
1107356554 13:39573579-39573601 AGTTATACCATGTAAAAGAAGGG - Intronic
1108015719 13:46073567-46073589 ATGTTTACTAAGTAGAGGAAAGG - Intronic
1108752916 13:53466444-53466466 ATTCATTCTAAATAGAAGAAAGG - Intergenic
1108831202 13:54480930-54480952 ATTTATTCTAGATAAAAGAAAGG + Intergenic
1110002188 13:70216880-70216902 ATTTATAAAACTTAGAAGACAGG + Intergenic
1110503471 13:76257110-76257132 ATTTATACTATGTAAAAGGTAGG - Intergenic
1110636457 13:77772903-77772925 CCTTATACTCCCTAGAAGAATGG - Intergenic
1111418705 13:87981136-87981158 ATATATATTAATTAGAAGAAGGG - Intergenic
1111734007 13:92114490-92114512 ATTTATACCAATTAGATGAATGG + Intronic
1113303175 13:109045376-109045398 ATTTATACAACCTAGAGCAATGG - Intronic
1113441931 13:110335790-110335812 GTTTAAACTCCATAGAAGAAAGG - Intronic
1113717555 13:112523587-112523609 ATTAAAACTACGTAGATCAATGG - Intronic
1114863135 14:26552475-26552497 AATTATACTATGTAGAACACTGG + Intronic
1115131255 14:30054576-30054598 ATGTAAACTCTGTAGAAGAATGG + Intronic
1116527494 14:45924734-45924756 ATTTAAAATATGTAGAAGAAAGG - Intergenic
1118969576 14:70622064-70622086 GTTTATGCCACGTAGAGGAAAGG - Intergenic
1120284481 14:82481050-82481072 AATCATACTACATAGAAAAATGG + Intergenic
1121212632 14:92220306-92220328 ATTTATATTATGTACCAGAATGG + Intergenic
1122454381 14:101838727-101838749 ATTTATACAACCAAGAAGAAAGG - Intronic
1123413796 15:20080870-20080892 ATTCATCCCACGTAGAAGAGGGG + Intergenic
1123523138 15:21087981-21088003 ATTCATCCCACGTAGAAGAGGGG + Intergenic
1131289759 15:91097369-91097391 ATTTACACTACACACAAGAATGG + Intergenic
1132094997 15:98977263-98977285 AATTAAACTAAGCAGAAGAAAGG - Intronic
1132300302 15:100771202-100771224 ATTGATGCTGCCTAGAAGAAAGG - Intergenic
1134667191 16:16027337-16027359 ATTTATAATACATAAATGAATGG + Intronic
1134903931 16:17963119-17963141 TTTCATACTACCTAGCAGAATGG - Intergenic
1137028965 16:35505113-35505135 ATTTTTACTACTTATAAGAATGG + Intergenic
1139053615 16:63155344-63155366 ATCTAAAGTAAGTAGAAGAAAGG + Intergenic
1149058803 17:52396267-52396289 ATTTAAACTATGTAGAAGGTGGG - Intergenic
1153316846 18:3731331-3731353 TTTTATACAAAGTAGAAGAGGGG - Intronic
1154390925 18:13935316-13935338 ACTTATACTAAGGAGAGGAAAGG - Intergenic
1155582646 18:27327542-27327564 AATTTTACAACGTAGATGAAAGG + Intergenic
1156068181 18:33171527-33171549 TTTTATATTACCTAAAAGAATGG + Intronic
1156183092 18:34629000-34629022 ATTTATGCTACTAAGAAGAACGG - Intronic
1158770374 18:60509215-60509237 AGTTGTACTAATTAGAAGAATGG - Intergenic
1160174549 18:76581957-76581979 ATTTATTCTACATGTAAGAAAGG - Intergenic
928242196 2:29596349-29596371 CTGTATACTACTTAGAAGATAGG - Intronic
928831134 2:35485049-35485071 TTTTCAACTACATAGAAGAATGG - Intergenic
931560224 2:63553576-63553598 ATTTACACAAAATAGAAGAATGG - Intronic
933142436 2:78809823-78809845 ATTTTCTCTACTTAGAAGAAAGG + Intergenic
933343563 2:81053191-81053213 ATATTTACTACGTAGAGGAAAGG + Intergenic
935606569 2:104977391-104977413 ATTTAAATTACTAAGAAGAATGG + Intergenic
936723384 2:115281329-115281351 ATTTCTACTAGCTAGAAGTAAGG + Intronic
941441797 2:165546751-165546773 ATCTTTATTACCTAGAAGAAAGG + Intronic
945130738 2:206569358-206569380 TTTTAAACTACGTAGTACAATGG + Intronic
948705188 2:239786903-239786925 ATTTATACTCTGTACCAGAATGG + Intronic
1170473296 20:16689493-16689515 ATTAATAATACATAGAAAAAGGG + Intergenic
1177311343 21:19398446-19398468 ATTTGTACTCCACAGAAGAATGG - Intergenic
1177328983 21:19631323-19631345 ATTTATATTATGTAGAAAAGGGG - Intergenic
1177458627 21:21379290-21379312 ATTCAAAATACATAGAAGAAAGG - Intronic
1177886181 21:26748575-26748597 ATTTAAATTACATAGAAGAGTGG - Intergenic
951972856 3:28467306-28467328 ATTTGTAGTACATAGAGGAAAGG + Intronic
954166469 3:48762910-48762932 ATTTATACTAAATTGTAGAAAGG + Intronic
954905344 3:54057845-54057867 ATTTATACTACCTATCACAAAGG - Intergenic
957165733 3:76670713-76670735 ATTTATAGTATTTAGAAAAATGG + Intronic
957328750 3:78731471-78731493 ATATATTCTATGCAGAAGAAAGG - Intronic
957650107 3:82990106-82990128 ATTTAAAATACTTAGAAGGAGGG + Intergenic
958876491 3:99623470-99623492 ATTTATTTTACATAGATGAAGGG + Intergenic
962511351 3:136104004-136104026 ATTTTTACTTCTTAGAGGAATGG - Intronic
962597423 3:136960798-136960820 ATTAAAACAAGGTAGAAGAAGGG + Intronic
963420446 3:145054829-145054851 ATTTAGCCTACGCAGAAGATAGG + Intergenic
963933741 3:151031449-151031471 AATTATAATACTTTGAAGAAAGG + Intergenic
963997740 3:151729916-151729938 ATTTATACAAGGTATAAGGAAGG + Intergenic
964319828 3:155483370-155483392 ATTTGTACTACACAGAAGCATGG + Intronic
964704051 3:159599520-159599542 AGTTATATTACTTAGAATAAGGG + Intronic
965173250 3:165295579-165295601 ATTTATACTAAGAAAAATAATGG - Intergenic
966510406 3:180756074-180756096 ATTTATACTTCCAAGAACAATGG - Intronic
967548818 3:190765269-190765291 ATTTTCACTAAGTAGCAGAAAGG + Intergenic
968348397 3:198031186-198031208 TTTTATACTACATTGAACAAAGG + Intronic
970905785 4:21214461-21214483 ATTTTTACTACCTAAAATAAAGG + Intronic
972859144 4:43145868-43145890 ATTGATACAATCTAGAAGAAGGG + Intergenic
977217588 4:94300176-94300198 CTTTATACTACGTAGTACAAAGG - Intronic
977217589 4:94300177-94300199 CTTTGTACTACGTAGTATAAAGG + Intronic
977240918 4:94567696-94567718 ATTTATAGTATGTAGAAGCAGGG + Intronic
977317115 4:95464091-95464113 ATTTCTATTACGTAACAGAAAGG + Intronic
977390733 4:96406988-96407010 ATTTATACTTCCTTGCAGAAAGG + Intergenic
980313264 4:131162974-131162996 ATTTATACTACTTATAAGTATGG - Intergenic
984013912 4:174403583-174403605 ACTGCTACTACGTAGAGGAAAGG - Intergenic
984175280 4:176409943-176409965 TTTTATACTAGGTTGAACAAAGG - Intergenic
984674318 4:182529540-182529562 ATTTATACTACGTAGAAGAAAGG - Intronic
986849092 5:11789970-11789992 ATTAATACTAGTCAGAAGAAAGG - Intronic
989118842 5:37983223-37983245 ACACATACTAAGTAGAAGAATGG + Intergenic
989362330 5:40616738-40616760 ATTTATGTTAAGTACAAGAAAGG + Intergenic
991412159 5:66356304-66356326 GTTTCTACTACCCAGAAGAATGG - Intergenic
997845967 5:137286307-137286329 ATTTATACTATGAGTAAGAAGGG + Intronic
999956286 5:156706201-156706223 GTTTATGCTATCTAGAAGAATGG - Intronic
1000862925 5:166477809-166477831 ATTTAAACTAAGTTGAAAAAGGG - Intergenic
1003796043 6:9606048-9606070 ATTTATACAAAATAGAAGAAAGG - Intronic
1004185524 6:13418172-13418194 ATTTTTACTAAGTAGGTGAATGG - Intronic
1004364634 6:15001443-15001465 ATTTATGCTCCTTAGAAGAATGG + Intergenic
1008161591 6:48083392-48083414 AGTTCTACTAAGAAGAAGAATGG + Intergenic
1008753170 6:54761544-54761566 ATTTGTATTACCTGGAAGAAAGG + Intergenic
1009913384 6:69961890-69961912 ATTTATACTAATTATATGAAAGG - Intronic
1013617251 6:111856000-111856022 ATTTATATTCCGTACCAGAATGG + Intronic
1015235967 6:130971457-130971479 ACTTTTATTACGTAGAATAAGGG + Intronic
1015454627 6:133412478-133412500 ATTTATACAAAGTAGAACACAGG - Intronic
1017728465 6:157293181-157293203 ATTTATACTCAGAAGAAGAAAGG - Intronic
1020927011 7:14341540-14341562 ATTTTTATTAGGTAGAAAAAAGG + Intronic
1021439564 7:20662347-20662369 ATTTATACTACTTAGAGGACTGG + Intronic
1026358245 7:69578807-69578829 ATTCATAGTAAGTAGAATAAAGG + Intergenic
1027515093 7:79132237-79132259 ATGTATACTACTTAGGTGAAGGG - Intronic
1028098272 7:86789218-86789240 ATTTAAACTACATAAAAGAGAGG + Intronic
1031123759 7:117749678-117749700 ATTTATACCACTTAGAAAATTGG - Intronic
1031542473 7:123011126-123011148 ATTTATACTATGTGGCAGGAGGG + Intergenic
1036984503 8:13512633-13512655 ATTTAGGCTAGATAGAAGAAAGG + Intronic
1038971496 8:32641248-32641270 ATTGATACTTTCTAGAAGAAAGG + Intronic
1040662095 8:49585178-49585200 ATTTATACAAAGTAGGAAAAAGG + Intergenic
1040760696 8:50838976-50838998 ATTTATTGTACAAAGAAGAAGGG + Intergenic
1042154642 8:65830387-65830409 ATGCATACAACCTAGAAGAATGG + Intronic
1043967019 8:86490197-86490219 ATTTATGGTAGGTAGAATAATGG + Intronic
1045126378 8:99094819-99094841 TTTTATAATACTTACAAGAATGG - Intronic
1045127935 8:99114407-99114429 ATTAATACTCAGTAGAAAAATGG - Intronic
1047915807 8:129582633-129582655 ATTTCAAATACATAGAAGAATGG - Intergenic
1048769114 8:137876712-137876734 ATTTATATTACTTAGAATATTGG - Intergenic
1048787295 8:138063697-138063719 ATTTATACAAAGTAGAAAAGTGG + Intergenic
1050540776 9:6667673-6667695 AATTCTACTAGGTAGAAGAGGGG - Intergenic
1050931511 9:11333917-11333939 ATGTCTGCTAAGTAGAAGAATGG - Intergenic
1052560984 9:30083031-30083053 ATTTATATTAGGTAGAAGGAGGG - Intergenic
1055759936 9:79596582-79596604 ATTTATACTACACAGGGGAAGGG - Intronic
1186503697 X:10073023-10073045 ATTTATGCTTCGTAGAACACTGG + Intronic
1189917998 X:45875921-45875943 ATTTATACAACATACAGGAAAGG + Intergenic
1190118583 X:47641804-47641826 ATTTACACTACATAGCAGAAAGG + Intronic
1191667739 X:63720709-63720731 ATTTATACAACGTGGAGGTAGGG + Intronic
1193023580 X:76820363-76820385 CTTTAAAATACGTAGAAGAGAGG - Intergenic
1194532112 X:95062904-95062926 ATTTATACTAAGTAAAACATTGG + Intergenic
1199503745 X:148538070-148538092 TTTGATACTACGTAGAAGGTTGG - Intronic