ID: 984674321

View in Genome Browser
Species Human (GRCh38)
Location 4:182529569-182529591
Sequence CACTCCACCCCATTTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984674318_984674321 6 Left 984674318 4:182529540-182529562 CCTTTCTTCTACGTAGTATAAAT 0: 1
1: 0
2: 0
3: 16
4: 149
Right 984674321 4:182529569-182529591 CACTCCACCCCATTTGGTTCAGG No data
984674317_984674321 22 Left 984674317 4:182529524-182529546 CCATTTCATTCTTCTTCCTTTCT 0: 1
1: 4
2: 57
3: 585
4: 4367
Right 984674321 4:182529569-182529591 CACTCCACCCCATTTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984674321 Original CRISPR CACTCCACCCCATTTGGTTC AGG Intronic
No off target data available for this crispr