ID: 984675926

View in Genome Browser
Species Human (GRCh38)
Location 4:182547784-182547806
Sequence TTTTAAATAAGGAGCTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 262}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984675926_984675930 13 Left 984675926 4:182547784-182547806 CCTTGATAGCTCCTTATTTAAAA 0: 1
1: 0
2: 0
3: 30
4: 262
Right 984675930 4:182547820-182547842 TTTTATCACTACAGATATTAAGG 0: 1
1: 0
2: 3
3: 28
4: 291
984675926_984675931 18 Left 984675926 4:182547784-182547806 CCTTGATAGCTCCTTATTTAAAA 0: 1
1: 0
2: 0
3: 30
4: 262
Right 984675931 4:182547825-182547847 TCACTACAGATATTAAGGCATGG 0: 1
1: 0
2: 1
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984675926 Original CRISPR TTTTAAATAAGGAGCTATCA AGG (reversed) Intronic
906245689 1:44272163-44272185 TTTTATAGAGGGAGCTACCAAGG + Intronic
907229882 1:52986804-52986826 TTTTATATAAGCAGCTTCCATGG - Intronic
908671191 1:66549470-66549492 TTTTAAATAAGGACCTAACCTGG + Intronic
910302352 1:85720738-85720760 TTATAGATAAGGAGTTATGATGG + Intergenic
911812663 1:102303250-102303272 TTTTAAATAAGGCCCCCTCAAGG + Intergenic
912149347 1:106838184-106838206 TTCTAAATAGGTAGGTATCAGGG + Intergenic
912501402 1:110124691-110124713 TTTTAAACAACCAGCTCTCATGG - Intergenic
912739990 1:112185714-112185736 TGTTAAATAAGAAGATATAATGG - Intergenic
913008785 1:114662167-114662189 GATTAAATAAGGATCTATTAAGG - Intronic
915819026 1:159001802-159001824 TTTTAAGTAAACAGATATCATGG - Intronic
917071239 1:171153143-171153165 ATTTAAATAATGATCTTTCATGG - Intronic
917194790 1:172453869-172453891 TCTTAAATGAGTAGCTATCAAGG + Intronic
921788785 1:219265084-219265106 TTTTAAATGAGGAGCATTAATGG + Intergenic
922553276 1:226513179-226513201 TTTTTAAAAATGAGCTCTCAGGG + Intergenic
922952313 1:229569384-229569406 ATATAAATAATGAGATATCATGG - Intergenic
923205941 1:231759009-231759031 TTTAAAACAAAGATCTATCATGG + Intronic
923783850 1:237049267-237049289 TTTCAAATGAGCAGCTGTCAGGG + Intronic
1063065714 10:2606334-2606356 TTTTAATCAATGAGCTCTCAGGG - Intergenic
1065059524 10:21884852-21884874 TTTTAAATAAGCATTTATAAAGG + Intronic
1065088144 10:22201222-22201244 TGTTAAATAGTGTGCTATCAAGG + Intergenic
1068160350 10:53254534-53254556 TTTTAAATAAGAAGATCTCGTGG - Intergenic
1068255774 10:54508883-54508905 TATTACATAATGAGATATCATGG + Intronic
1068446055 10:57125232-57125254 TTTCAAATAACCAGCTCTCATGG - Intergenic
1068795022 10:61069959-61069981 TTTTTAATAAGCAGCTCTCCTGG + Intergenic
1068971926 10:62968098-62968120 TTTTTAATAGAGAGCTATTAGGG + Intergenic
1069195949 10:65551536-65551558 TTTTAAACAACCAGCTATCTTGG - Intergenic
1072296806 10:94016346-94016368 TTATACATAATGAGCTATCTTGG + Intronic
1072811942 10:98468678-98468700 TATTAACTAAACAGCTATCATGG - Intronic
1073950073 10:108797354-108797376 TTTTTAACAACCAGCTATCATGG + Intergenic
1074650979 10:115524121-115524143 TTTTAAATAACCAGCTGTCATGG + Intronic
1074666035 10:115726078-115726100 TTTTAAATAATAAACTGTCATGG + Intronic
1074800140 10:116991532-116991554 TTTTCAACAAGTAGCTCTCAGGG + Intronic
1074960772 10:118443407-118443429 TTTTAAATTAAGTGCTTTCAAGG - Intergenic
1075010737 10:118867786-118867808 TTTGAAATAAAGAACTGTCATGG + Intergenic
1075964192 10:126596358-126596380 TTTTAAATAAGTGTCTTTCAAGG - Intronic
1080909806 11:36584229-36584251 TTTTAAAAATGAGGCTATCAAGG - Intronic
1081642218 11:44764075-44764097 TTTTAAACAAGCAGATCTCACGG + Intronic
1081939720 11:46930355-46930377 TTTTAAATAAGGAAGTAACATGG + Intergenic
1082064500 11:47888624-47888646 TTTTCAATAAGAAAGTATCAGGG + Intergenic
1083028106 11:59567628-59567650 TCATAAATAAGGAGCCAGCATGG + Intergenic
1085412971 11:76302455-76302477 TTTTAATTAAAAAGCCATCAAGG + Intergenic
1085825766 11:79845567-79845589 TTTTAAAGTAGGACCTTTCAGGG - Intergenic
1086115674 11:83247025-83247047 TTTTAAATCAGGAGCTTTCTTGG + Intronic
1086445506 11:86866785-86866807 TTTTTAACAAGCAGCTCTCATGG - Intronic
1086605707 11:88693670-88693692 TTTTAGAGAAAGAGCTATCCTGG - Intronic
1090685943 11:129119753-129119775 TTTTAAAAGAGGAGGTAGCAAGG + Intronic
1091483329 12:857495-857517 TTTTAAGTAAGCAGTTCTCATGG - Intronic
1093126869 12:15340689-15340711 TTTTAAATCTGGAGCTTTTATGG + Intronic
1093306666 12:17528583-17528605 TTTTAAACAACCAGCTCTCATGG - Intergenic
1095858713 12:46890719-46890741 TGGTGAATAAGGAGCTGTCAGGG + Intergenic
1096768539 12:53915431-53915453 TTTAAAATATTCAGCTATCATGG + Intergenic
1100850166 12:98701947-98701969 TTTTAAAAAATGACCTATCTTGG + Intronic
1102737554 12:115176410-115176432 TTATAAATAATCAACTATCAAGG - Intergenic
1102806700 12:115787680-115787702 TTTTCCTTAAGGATCTATCATGG - Intergenic
1104396505 12:128438326-128438348 TTTTAAACAACCAGCTCTCATGG - Intronic
1104470671 12:129027013-129027035 TTATAAACAAGGAGGTTTCATGG - Intergenic
1104742341 12:131187957-131187979 TTTTTAATAATCAGCTCTCATGG + Intergenic
1105331870 13:19425252-19425274 TTTAAATTAAAGACCTATCATGG - Intronic
1106092775 13:26612803-26612825 TTTTAAGTAAGGAGCTAATAAGG - Intronic
1106846416 13:33742410-33742432 TTTTTAATAACAAGCTCTCATGG - Intergenic
1109256015 13:60083746-60083768 TTTTAAATAAAGACCAAGCACGG + Intronic
1109575015 13:64243913-64243935 TTTCAGATGAGGAACTATCAGGG + Intergenic
1109660491 13:65452493-65452515 TTATAAATATGAAGCTAACAAGG + Intergenic
1109716162 13:66225323-66225345 TTTTTAATAACCAGCTCTCAAGG - Intergenic
1110612324 13:77502757-77502779 TTTCAGAAAAGGAACTATCAGGG + Intergenic
1110673824 13:78214515-78214537 TTTTAAATAATAAGCTTCCACGG - Intergenic
1110949559 13:81468401-81468423 TTTTAAATAAGTAGCTATGCTGG - Intergenic
1111304937 13:86397955-86397977 TGTTATATAAGTAGTTATCATGG + Intergenic
1117535626 14:56700124-56700146 TTTTAAAAAAGGATTTCTCATGG + Intronic
1117596674 14:57332782-57332804 GATTAAATCAGGAGTTATCAGGG + Intergenic
1118381327 14:65219881-65219903 TTTTAAAGAAGGAATTATTATGG + Intergenic
1118423112 14:65629922-65629944 TTTTGAGTAAGGAGACATCAGGG + Intronic
1118734874 14:68694082-68694104 TTTTAGAGAAGGAGCTCCCAGGG + Intronic
1119496900 14:75087507-75087529 TTTTAAATGAGAAGATACCAAGG - Intronic
1120261942 14:82196944-82196966 TCTTAAACAAGGAGGTCTCAAGG - Intergenic
1120474166 14:84966731-84966753 TTTTAATTAAGAAGCTACTAGGG - Intergenic
1121197776 14:92089636-92089658 TTTTAAAAAAGTATCTAACAGGG - Intronic
1122697653 14:103564272-103564294 ATTTAAACAAGGAGTTACCAGGG + Intronic
1125663336 15:41411726-41411748 TTTTAAATAATGTACTATTATGG - Intronic
1129933398 15:79430820-79430842 CTTTAAATAACGCCCTATCAGGG - Intergenic
1135471617 16:22736443-22736465 TTTTAAATAACCAGCTCTCATGG + Intergenic
1135684151 16:24484642-24484664 TTTTAAAAATGGATATATCATGG - Intergenic
1136491054 16:30608770-30608792 TTTTAAGCAAGGAAATATCATGG + Intronic
1138141520 16:54572650-54572672 TAATAAAGAATGAGCTATCAAGG - Intergenic
1139119235 16:63995480-63995502 TTTTAAATAAGCAGTGTTCATGG - Intergenic
1140875449 16:79147820-79147842 TTTAAAATTATTAGCTATCAGGG - Intronic
1141162028 16:81635736-81635758 TTATAAATAAGGAGTTTTCAGGG + Intronic
1141504246 16:84464155-84464177 TTTTAAATAAAGTGCTATGCCGG + Exonic
1143716539 17:8775419-8775441 TTTTAAACAACGTGCTTTCATGG - Intergenic
1144411002 17:15001722-15001744 TTTTAAACAACCAGCTCTCATGG - Intergenic
1144631083 17:16872849-16872871 TTTTAAATAAAGAGGCAACAGGG + Intergenic
1144650209 17:17002490-17002512 TTTTAAATAAAGAGACAACAGGG - Intergenic
1148810653 17:50288718-50288740 TTTCACATAAGGGGCTAACATGG - Intergenic
1149873470 17:60204924-60204946 TTTTAACTAAGCAGCCATGATGG - Intronic
1150087252 17:62282179-62282201 TTTTAACTAAGCAGCCATGATGG - Intronic
1155496553 18:26448395-26448417 TTTCAAATAAAGAGCAATAATGG + Intergenic
1156118363 18:33814340-33814362 ATGTAAAGAAGTAGCTATCATGG + Intergenic
1156566317 18:38195375-38195397 TTTTAAATAAGGATTTCTGAAGG - Intergenic
1158309292 18:56141224-56141246 TTTTCAATATGAAGCTTTCAAGG + Intergenic
1158915588 18:62124085-62124107 TTCTGAATAAGGAGTTGTCAGGG - Intronic
1159660346 18:71088521-71088543 TTTGAAATTAGGTGCAATCAAGG + Intergenic
1160114041 18:76060342-76060364 TTTTAAATATGAGGCTATCAAGG - Intergenic
1161533791 19:4806289-4806311 TTTTAAATGAGGAGCACGCATGG + Intergenic
1162693871 19:12456492-12456514 TGTTAAAGAAGGTGCTACCAGGG + Intronic
1164123343 19:22287576-22287598 TTTTTAAAAAGTAGATATCAGGG + Intronic
1165701884 19:37944493-37944515 TTTTAAAGATGGAGAAATCAAGG - Intronic
1166175575 19:41066701-41066723 TTTTAAACAACCAGCTCTCATGG - Intergenic
1166240110 19:41485379-41485401 TTTTGAACAAGGAGATATTAAGG - Intergenic
1167570481 19:50284764-50284786 TTTTACATATGATGCTATCATGG + Intronic
925154965 2:1641820-1641842 TTCTTAATAAGCAGCTAACAGGG + Intronic
925729821 2:6911245-6911267 TTTAAAATAAAGAGCTATGGGGG - Intergenic
925803618 2:7626994-7627016 TTTTAAACAAGGTGCAGTCATGG - Intergenic
926082003 2:9994886-9994908 TTTAAAATATGGTGGTATCATGG - Intronic
926122328 2:10250661-10250683 TTTTACAGAAGGAGCACTCAGGG - Intergenic
927344053 2:22016174-22016196 TTTTAAATAAAGAGTGATAAGGG + Intergenic
928224062 2:29432300-29432322 TTTTAAATAACCAGATCTCATGG - Intronic
928777550 2:34783852-34783874 TTTTAAAAAATAAACTATCAAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930506834 2:52293286-52293308 TTTTTAATAAAGAGCTATATGGG - Intergenic
932874037 2:75431954-75431976 TTTTTAATAACCAGCTCTCATGG + Intergenic
933027061 2:77272739-77272761 TTTTTAATAACCAGCTCTCATGG - Intronic
935512894 2:103997873-103997895 TTTTAAAGAAGGAGAAAACAGGG - Intergenic
939063641 2:137455560-137455582 TTTTAGAGAAAGAGCTATCATGG - Intronic
939241824 2:139571453-139571475 TTTTAAACAACCAGCTCTCATGG - Intergenic
939974800 2:148705172-148705194 ATATAAATTAGGTGCTATCAAGG - Intronic
940151047 2:150600994-150601016 TTTACAATAAGAAGCTGTCATGG - Intergenic
941426654 2:165354680-165354702 GTTTAAATAAGGAGATATTTTGG + Intronic
942518942 2:176782749-176782771 TTTTAAATAAGCAGCTCTTATGG - Intergenic
942569629 2:177300850-177300872 TTTTAAATAATGGGTTATCAAGG - Intronic
943104948 2:183533251-183533273 TTTTAAACAACCAGCTCTCAAGG + Intergenic
943533554 2:189118133-189118155 ATTTAAATAAGCAGCTAAAATGG - Intronic
943914801 2:193616897-193616919 TTTTAAGTAAGAAACTGTCATGG + Intergenic
945065252 2:205942839-205942861 TTTTAAAAAAAGAGCTACCCAGG + Intergenic
945701721 2:213178875-213178897 TTATAAATAAGGAACTATGCTGG + Intergenic
946621040 2:221563409-221563431 CTTTAAGTAAGGATCAATCAAGG + Intronic
946889026 2:224255189-224255211 TTTAAAATTAGGTGCGATCAAGG + Intergenic
947165033 2:227253108-227253130 TTTTAAAGGAGGAGCTCTTAAGG - Intronic
948345144 2:237289819-237289841 TTCTAAACAAGAAGCCATCAAGG + Intergenic
1170659903 20:18327691-18327713 TTTTAAATAAAAAGCCATAAAGG - Intergenic
1170947813 20:20907695-20907717 TTTTAAAAGAGGTGCTCTCAAGG + Intergenic
1173128395 20:40362442-40362464 TTTTAAAGGAGGAACTAACATGG + Intergenic
1177042056 21:16125842-16125864 TTTAAAATAAGCAGCTATTCTGG + Intergenic
1177167814 21:17622748-17622770 TTGTAAATATTGAACTATCATGG + Intergenic
1177893170 21:26831646-26831668 TCTTAAATAAGGAGATATGTGGG - Intergenic
1179139341 21:38710484-38710506 TTTTAAATAAGCAACTTTTATGG + Intergenic
1184266336 22:43348708-43348730 TTTTAAACAAGGAGATCTCGTGG - Intergenic
949689383 3:6617991-6618013 GTTTACATAAGGAGATATCTTGG + Intergenic
950026221 3:9821697-9821719 TTTTAAATTAAGAATTATCAAGG + Intronic
950749000 3:15114048-15114070 TTTTCAATATGGAGCTTCCAAGG + Intergenic
951376713 3:21927085-21927107 TCTTAAACAATAAGCTATCATGG - Intronic
953363176 3:42318797-42318819 TTTTAAACCAGTGGCTATCATGG - Intergenic
955142008 3:56278811-56278833 TTTTAAAGAACCAGCTATCATGG + Intronic
955579232 3:60401085-60401107 CTTTAAATCAGGTGCTACCAGGG - Intronic
956434737 3:69223213-69223235 TTTTAATTAAAAAACTATCAAGG + Intronic
956482789 3:69689617-69689639 TTTTTAATAACCAGCAATCACGG + Intergenic
956705776 3:71997846-71997868 TTTTGAAAAAGGAGATATAAAGG - Intergenic
957372676 3:79315904-79315926 TTTTAAAGAATAAGCTAACAAGG + Intronic
957556709 3:81771268-81771290 TTTCAAATAAGGAACAACCAAGG - Intergenic
957753735 3:84459131-84459153 TTTTAAATAATGAATTATGAGGG - Intergenic
959577600 3:107951075-107951097 TTTTAAATAAGGAGTTCGCTTGG - Intergenic
960300568 3:115998307-115998329 TTTTCAAAAAGGCTCTATCATGG + Intronic
960410434 3:117316894-117316916 GTTTTAATCAGGAGTTATCAGGG - Intergenic
960453787 3:117844142-117844164 TTTTACAAAAGGAAATATCATGG - Intergenic
960774686 3:121236544-121236566 TTTTAAACAACCAGCTCTCATGG + Intronic
960852269 3:122068236-122068258 TTTTACATAAGGTGCTTTCACGG + Intronic
963583788 3:147159366-147159388 TTTTTAACAAGCAGCTCTCATGG + Intergenic
964440580 3:156704574-156704596 GTTTTAATGAGGAGTTATCAAGG - Intronic
965813822 3:172616960-172616982 TTTGAAATTAGGTGCAATCAAGG - Intergenic
965840871 3:172904404-172904426 TTTTAAACAAGAATTTATCAAGG - Intronic
966803878 3:183790563-183790585 TTTAAAACAAGGAAGTATCATGG - Intronic
967482043 3:189983911-189983933 TTTTAAATAATGAGCTTTCTTGG + Intronic
967765480 3:193274758-193274780 TTTAAAATGAGCAGCTGTCATGG - Intronic
968861663 4:3176337-3176359 TTTTAATGAAGGAGGCATCAAGG + Intronic
969838444 4:9862520-9862542 TTTCAACTAAGGACCTATGAGGG + Intronic
970054768 4:11958357-11958379 TTTTAAATCAGGAATTATGATGG + Intergenic
970855431 4:20645749-20645771 TTTTTATTAAGGAGATATCCTGG + Intergenic
971305926 4:25481551-25481573 TTTGGAATAAGGAGCAATTAAGG - Intergenic
971833472 4:31730639-31730661 ATTTAAAAAGGGAGCTATGATGG - Intergenic
971964395 4:33533775-33533797 TTTTAAACAAAGAGATATTATGG - Intergenic
972731708 4:41801344-41801366 TTTTAAATATGGAGTGGTCAGGG - Intergenic
975151786 4:71031445-71031467 TTTTAAAAAATTAGCCATCATGG - Intergenic
976018526 4:80590669-80590691 TTTTAAATAATAAGTTATTAAGG - Intronic
979027045 4:115590339-115590361 TTTTAAATACGAAGCTAACTGGG + Intergenic
979067871 4:116161298-116161320 TTTAAAAAAATGAGCTCTCAAGG - Intergenic
980004276 4:127523618-127523640 TTTTAAACAACCAGCTTTCATGG - Intergenic
980784864 4:137539397-137539419 CTTTTAACAAGGAGCAATCAAGG + Intergenic
980923545 4:139112597-139112619 TTTTAAATGAGTAGCAAACAAGG - Intronic
981515314 4:145602201-145602223 CTTTAAATAATGAGCTATTTTGG - Intergenic
981775236 4:148359618-148359640 TTTTAAAAAAGGGGCTATGGTGG + Intronic
981797922 4:148619092-148619114 TTTTTAACAACCAGCTATCATGG - Intergenic
982842482 4:160208654-160208676 TTTTAGTTAATGAGGTATCATGG + Intergenic
983290796 4:165801258-165801280 TTTTAAATAAGAAATTATCAAGG - Intergenic
983586656 4:169362890-169362912 TTTTAAACAACCAGCTCTCATGG + Intergenic
983875574 4:172871069-172871091 TTTTAAGTAAGGGGGTAGCAGGG + Intronic
984042388 4:174750973-174750995 TTTTACATAGGGATCTATCTAGG + Intronic
984675926 4:182547784-182547806 TTTTAAATAAGGAGCTATCAAGG - Intronic
987448875 5:18056358-18056380 TTTTAAATCAAGATCTATAAAGG - Intergenic
988155271 5:27441769-27441791 TGTTAAAGAAGGAGATGTCACGG - Intergenic
988606866 5:32686120-32686142 TTTTAAACAACCAGCTCTCAAGG - Intergenic
993002667 5:82397318-82397340 TTCTATATAAGGAGTTAACATGG - Intergenic
993400007 5:87437635-87437657 TTTTAAAAGAGCAGCTATGAAGG - Intergenic
993458276 5:88150426-88150448 TTTAAAATGAGGAGCTGTAATGG - Intergenic
994474360 5:100248721-100248743 TTTTAAACAAGCAGGCATCAGGG - Intergenic
994630869 5:102285747-102285769 TTTTAGATTAGAAGCTATAATGG - Intronic
995283710 5:110363180-110363202 TTTTAAATAGGCAGATCTCAAGG + Intronic
996755028 5:126926636-126926658 TTTTGAGTAAGGAGCTGTCTGGG + Intronic
996915638 5:128708927-128708949 TTTTAAAAATGGAGCAATGATGG - Intronic
997829259 5:137135057-137135079 TTTTAAATAAGGAGCAGACATGG - Intronic
999260596 5:150236213-150236235 ATGTAAATTAGGAGCCATCAAGG - Intronic
1001834680 5:174822003-174822025 TTTTAAATAAGGATCAATGATGG - Intergenic
1003220046 6:4153151-4153173 TTTTAGGTAAGGAGCACTCACGG - Intergenic
1003785092 6:9476674-9476696 TATTAATCAAAGAGCTATCATGG + Intergenic
1004244372 6:13958940-13958962 TTTTTAACAATGAGCTCTCAAGG - Intronic
1005568877 6:27125239-27125261 TTTAAAATAAGGAGAAATCTAGG + Intergenic
1007481466 6:42153106-42153128 GATTAAATCAGGAGTTATCAGGG + Intergenic
1008126421 6:47674142-47674164 TTTTAAATGAGTAACTAACAGGG - Intronic
1008511029 6:52276059-52276081 TTTTAAATAAGGAACTTTCCAGG + Intronic
1009542681 6:64983010-64983032 TATTAAATAAATAGATATCATGG + Intronic
1009844981 6:69123118-69123140 TTCTAATTGAGGAGCTATTATGG + Intronic
1009993947 6:70878768-70878790 TTTTAAATAAGGAATTTTAAAGG - Intronic
1010545036 6:77143033-77143055 TTTTAAATAATTAGATATTAGGG - Intergenic
1011716049 6:90106230-90106252 ATTAAAATAATGAGCTATGAAGG - Intronic
1011995425 6:93581085-93581107 TTTTAAATAATTAGAAATCAGGG - Intergenic
1012338913 6:98094158-98094180 TTTTAAATAAGCTCCAATCAGGG - Intergenic
1013018979 6:106191366-106191388 AGTTAAATGAGAAGCTATCATGG - Intronic
1013128764 6:107211428-107211450 TTTTATATAAAGAGCTATAAGGG + Intronic
1013885858 6:114965920-114965942 TATTAAATTAGGATTTATCAAGG + Intergenic
1013911378 6:115279838-115279860 TTTTAAACAATCAGCTCTCACGG - Intergenic
1014727331 6:124987513-124987535 TTTGAAATAAGGAAATTTCAAGG + Intronic
1015829800 6:137356460-137356482 TTTTAAAAAAAGAAGTATCAGGG - Intergenic
1016448939 6:144161183-144161205 TTTTAAATAAGAAGCAATGATGG + Intronic
1017326699 6:153149267-153149289 TTTTAAACAACCAGCTCTCATGG + Intergenic
1017559507 6:155611499-155611521 TTATAAATAAAGAGGTTTCATGG - Intergenic
1017759246 6:157555636-157555658 TTAAAAAAAAGAAGCTATCAGGG - Intronic
1019934236 7:4243952-4243974 TTTTATCTAAGGAGCTAAAATGG - Intronic
1021542007 7:21770234-21770256 ATTTACATAATGAGATATCATGG + Intronic
1022276190 7:28857129-28857151 TTTAAAGTAGGGAGATATCACGG - Intergenic
1023355380 7:39362089-39362111 TTTTAAACAAGGGGATAGCAAGG - Intronic
1024346204 7:48316829-48316851 TTTTAAACAAGCAGCTCTCTTGG + Intronic
1025712216 7:63922913-63922935 TTTAAAAAAATGAGCTGTCAAGG + Intergenic
1027492353 7:78844782-78844804 TTTTAAAGAAGCAGATTTCATGG + Intronic
1028278729 7:88893922-88893944 TTTAAAATAAGGAAACATCATGG + Intronic
1030501968 7:110370492-110370514 TTATAAAAAAGGTGCTATGAGGG - Intergenic
1030976120 7:116125688-116125710 TTAAATATAAAGAGCTATCAAGG + Intronic
1031667033 7:124496992-124497014 TTTTAAATAAAGAGCCCTTAAGG - Intergenic
1031867366 7:127052386-127052408 TTGTAAACAAGGGGCTATTAAGG - Intronic
1031874550 7:127123419-127123441 TTTTAAATAACTAGCTATTGAGG - Intronic
1033509080 7:142036557-142036579 TTTTAAATAAGAAGCAAACAAGG + Intronic
1034290488 7:149927214-149927236 TTTTGAATAATCAGCCATCATGG - Intergenic
1034660585 7:152765627-152765649 TTTTGAATAATCAGCTATCATGG + Intronic
1036103786 8:5817634-5817656 TTTTAAATCAGGAGCCAACATGG - Intergenic
1036167875 8:6454409-6454431 TTTTGAAGGAGGAGCTAACATGG - Intronic
1037290397 8:17343641-17343663 TTTTAAATGAGGAACTATACTGG + Intronic
1037503399 8:19506688-19506710 TTTTCAACAAGGAGTTCTCATGG - Intronic
1042231721 8:66562013-66562035 TTTTAAATGAGGCTCTATAAAGG + Intergenic
1042769732 8:72366500-72366522 AGTTAAATAAGGGGCTATCTAGG - Intergenic
1042782551 8:72508178-72508200 TTTCAGAGAAGGAGCTCTCAGGG - Intergenic
1044098097 8:88094628-88094650 TTTGCAATACGTAGCTATCAAGG + Intronic
1044221162 8:89671697-89671719 TTTTAAAAGAGGAGCACTCAGGG + Intergenic
1045029242 8:98119217-98119239 TTTTAAATAAGAAGCTATTTTGG + Intronic
1046214237 8:111121415-111121437 TTTGAAATAAGTAGATATCAGGG - Intergenic
1046325732 8:112642370-112642392 TTGTAAATAAGGAGCAATGTAGG + Intronic
1046965461 8:120160198-120160220 TTTTTAAAAATAAGCTATCATGG + Intronic
1048765174 8:137835927-137835949 ATTCCAATAAAGAGCTATCAGGG + Intergenic
1050103847 9:2145366-2145388 TTTTAAGTAAGGAGCAATGGAGG + Intronic
1053183980 9:35999106-35999128 TTTTAAAAAAAGAGCAAACATGG - Intergenic
1054787915 9:69226795-69226817 TTTTAAAGAATGAGCAATTAAGG - Intronic
1054951231 9:70854115-70854137 TTTGAAATTAGGAGCTATTTTGG + Intronic
1055062864 9:72088733-72088755 TTTTTAATGAGGGGCTATTAAGG + Intergenic
1055190634 9:73518019-73518041 TCTTATATTAGGAGCTATGAAGG + Intergenic
1056161850 9:83904104-83904126 TTTTAAAAAAGGGACTATCTTGG - Intronic
1056936295 9:90917367-90917389 ATTTAAATTATGAGATATCAAGG + Intergenic
1058023738 9:100117721-100117743 TTTTATATATGGTGCTATTATGG + Intronic
1058365528 9:104204157-104204179 TTTTAGATAGGGAGGTCTCAGGG - Intergenic
1059970824 9:119666540-119666562 TTTTAAAAAATGAGTTATTATGG - Intergenic
1060483863 9:124034841-124034863 TTTTTAAATAGGAGCTATCTTGG - Intergenic
1060578995 9:124726486-124726508 TTTTCACTAAGAAGCAATCATGG - Intronic
1186024429 X:5293407-5293429 TTTAAATTAATGAGCTATCTGGG + Intergenic
1186714081 X:12231927-12231949 TTTTAAATAGGGAGCTGGTATGG - Intronic
1188190384 X:27165293-27165315 TTTTAAAAGAGTTGCTATCATGG - Intergenic
1188713324 X:33429348-33429370 TTTTTAATAACCAGCTCTCATGG - Intergenic
1189187547 X:39067062-39067084 TTTTAAGTAAGGAGCCAACAAGG - Intergenic
1191031958 X:55983631-55983653 TTTTAAATAAATAGCTTTAATGG + Intergenic
1193743906 X:85251927-85251949 TTTTAAATAAGGAGGAACTATGG - Intronic
1193960533 X:87919792-87919814 TTTTTAACAACCAGCTATCATGG + Intergenic
1194705588 X:97171638-97171660 TTTTAAATAAGAAACTTTCCGGG + Intronic
1195300147 X:103521704-103521726 TTTTAAAAAAGGGGTTTTCATGG + Intergenic
1195632070 X:107067677-107067699 TTTTAGATAAGGAGATAGCATGG - Exonic
1196343565 X:114625430-114625452 TTTTTAATAACCAGCTCTCATGG - Intronic
1197003521 X:121468978-121469000 TTTTAAAAAATCAGATATCATGG + Intergenic
1197154560 X:123256354-123256376 ATTTAAATAAGGTGCTATGAAGG + Intronic
1197508138 X:127334344-127334366 ATTTAAATTATGAGCTGTCAAGG + Intergenic
1200308734 X:155055492-155055514 TTTTAAAGAAGTAGCTTTCCAGG + Exonic