ID: 984677620

View in Genome Browser
Species Human (GRCh38)
Location 4:182568374-182568396
Sequence TTGGAGAAACAGAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 881
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 796}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984677614_984677620 30 Left 984677614 4:182568321-182568343 CCAAAACCTGCAGAAGAGAGGGA 0: 1
1: 0
2: 2
3: 51
4: 638
Right 984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG 0: 1
1: 0
2: 7
3: 77
4: 796
984677615_984677620 24 Left 984677615 4:182568327-182568349 CCTGCAGAAGAGAGGGAATAATT 0: 1
1: 0
2: 3
3: 69
4: 723
Right 984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG 0: 1
1: 0
2: 7
3: 77
4: 796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984677620 Original CRISPR TTGGAGAAACAGAATGAGAA GGG Intronic
900340125 1:2184559-2184581 TTGGAAAAACAATAGGAGAAGGG - Intronic
901108637 1:6777489-6777511 TTGAAGAAAAATAATGTGAAAGG - Intergenic
901522088 1:9792886-9792908 TTTGTGAAACGGAGTGAGAAGGG + Intronic
902202341 1:14843282-14843304 TTTGAGAAAAAGAATAATAAGGG + Intronic
902850267 1:19149893-19149915 TCGGGGAAAAAGAAAGAGAAAGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903226425 1:21896469-21896491 TTGGGGAAACTGAATCAAAAGGG - Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904597053 1:31653529-31653551 TAGAAGAAACAGAAAGAAAAGGG + Intronic
904781322 1:32951135-32951157 TTGAAGAAAAAAAATGAAAAAGG - Intronic
905252770 1:36660136-36660158 TTGGAGAGAGTGAATGGGAAGGG - Intergenic
905657351 1:39693171-39693193 TGGGAGGCCCAGAATGAGAAGGG - Intronic
906014133 1:42558671-42558693 TTGGAGTACCAGAAGGAGACGGG + Intronic
906138160 1:43515084-43515106 TGGGAGAACGGGAATGAGAAGGG - Intergenic
907778612 1:57543336-57543358 TTGCAGAAACAGCATGACATAGG - Intronic
907942633 1:59104301-59104323 TTGGAGAAAATGAAGGAAAAAGG + Intergenic
907972575 1:59398014-59398036 CTGGAGAAACAAAATTAGAAGGG - Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
909135359 1:71792421-71792443 TTGGTGAAACAGGATGAGAAGGG - Intronic
909539818 1:76778876-76778898 TTGGGAAAAGAGAATGAGAGAGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
911411650 1:97516835-97516857 TTGGAGATAGAGAGAGAGAAGGG - Intronic
911493744 1:98603519-98603541 TTAGAGAAACACAATGATATTGG + Intergenic
911508697 1:98785266-98785288 TTGGAGTACCAGAAGGAGATGGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911940338 1:104038202-104038224 TTGGACATACAGTAGGAGAAAGG - Intergenic
912226906 1:107744180-107744202 TGGGACGAAGAGAATGAGAATGG - Intronic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
913487797 1:119349378-119349400 TTGGAAAATCAGAAAGAAAAAGG + Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
914686394 1:149983555-149983577 TTGGAGAGACAAATTGGGAAAGG + Intronic
914703967 1:150156581-150156603 TTGAAGAAATAGAATGTGACAGG - Intronic
915444285 1:155966077-155966099 TTGGTGTAACAGAAAGAGCATGG - Intronic
915516272 1:156414437-156414459 TTGGGGAGTCTGAATGAGAAGGG - Intronic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916671358 1:167024112-167024134 TTTGAGGAAAAGAATGGGAATGG - Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917747311 1:178023200-178023222 TCGTAGAAACAGAAAGTGAATGG + Intergenic
918156371 1:181850628-181850650 TTGGAGTACCAGAAGGAGACAGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919586471 1:199446749-199446771 TTGGAGTACCAGAAGGAGACGGG - Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921315749 1:213888553-213888575 TTGGAGAAAGAGGAGGAGTAAGG + Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921627633 1:217395317-217395339 TTGGAGAGAGAGAAAAAGAAGGG - Intergenic
921879937 1:220244774-220244796 TTGGCAAAGCAGAATGACAATGG + Intronic
921898885 1:220429424-220429446 TTGGAGAGGCAGAATAACAATGG + Intergenic
923110505 1:230886109-230886131 TTGGAGAGAGACAGTGAGAATGG + Intergenic
923482286 1:234396881-234396903 TGGGGGACTCAGAATGAGAAGGG + Intronic
1063090459 10:2861666-2861688 TTTGAGAAAGGGATTGAGAAAGG - Intergenic
1063647449 10:7899228-7899250 ATGGAGGGACCGAATGAGAACGG - Intronic
1063741413 10:8825595-8825617 GTGTAGAAAAAGACTGAGAAGGG + Intergenic
1063799580 10:9558098-9558120 TTAAAGAAAAAGAATGACAAGGG + Intergenic
1064227204 10:13497629-13497651 TGAGAGAAACAGAATAAGATAGG - Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1065092027 10:22244830-22244852 TTGGAGAGAAAGAAAGAGAGAGG - Intergenic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065784030 10:29196441-29196463 TTGGAGAAAGTGGCTGAGAAGGG - Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066555156 10:36604390-36604412 TAGGAGATACAGAAAGATAATGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068126726 10:52850229-52850251 TTGGAGTACCAGAAGGAGACGGG - Intergenic
1068154165 10:53174878-53174900 TTGCAAAAATAAAATGAGAAAGG + Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071071448 10:81698432-81698454 TTGGAGTACCAGAAGGAGATGGG + Intergenic
1071077064 10:81767761-81767783 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071156044 10:82690919-82690941 TGGAAGAAAGAGAATGAGCAGGG - Intronic
1071178143 10:82951439-82951461 TTTGAAAAACAAAATTAGAATGG - Intronic
1071204738 10:83261232-83261254 TTGGAGACACGGAATCAGAGTGG - Intergenic
1071558640 10:86627675-86627697 TTGAAGGAAAAGAATGAGAGAGG - Intergenic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073839981 10:107487209-107487231 TTGGTGAAACAAAATAAGAAAGG + Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1076146733 10:128127736-128127758 TGGGAGCATGAGAATGAGAAGGG - Intergenic
1076273214 10:129174667-129174689 TTGGAGAGAGAGAGAGAGAAGGG - Intergenic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078006353 11:7535320-7535342 TTGAGGAAACAGCATGACAAAGG + Intronic
1078360381 11:10663276-10663298 TAGGAGGAACTGAATGAGAGAGG - Intronic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079896296 11:26122862-26122884 TTGGAAAAACAGAATTTTAAAGG - Intergenic
1080164737 11:29223571-29223593 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1080381785 11:31779389-31779411 TGGGAGAAACGGAATTAGGAAGG + Intronic
1080397878 11:31906596-31906618 AGGGAGAGACAGAAAGAGAAGGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081142457 11:39518687-39518709 TTTGACAAACAGAATTAGATGGG - Intergenic
1081227796 11:40546137-40546159 TTAGAGAGAAAGAAAGAGAAAGG - Intronic
1081362341 11:42195968-42195990 AGGGAGAAAAAGAAAGAGAAAGG - Intergenic
1081454802 11:43211311-43211333 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1081877104 11:46416098-46416120 TTGGAGAAACAGGGAAAGAAAGG + Intronic
1082207166 11:49451675-49451697 TAGGAGAATAAGAATTAGAAAGG - Intergenic
1082728769 11:56769610-56769632 TTAAAGAAAAGGAATGAGAAGGG - Intergenic
1083254404 11:61487276-61487298 TTTGAGAAACAGACTGAGACTGG + Intronic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084737492 11:71115007-71115029 TTGGAGAAATAGCAAGAAAAAGG - Intronic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086475729 11:87171078-87171100 TAGGAGAAACAATATGAAAAGGG + Intronic
1086597928 11:88596251-88596273 GGGAAGAAACAGAATGAAAAGGG - Intronic
1086648110 11:89250061-89250083 TAGGAGAATAAGAATTAGAAAGG + Intronic
1086899066 11:92345837-92345859 TTGAGGAAACAGATTGAGACAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087293980 11:96347972-96347994 TTAGATAAACAGAATTTGAATGG + Intergenic
1087307890 11:96505897-96505919 TTGGAGAGAGAGAAAGAGATGGG - Intronic
1087444592 11:98234076-98234098 TGAGAGAAAAAGAATGAGAGAGG - Intergenic
1087982580 11:104634361-104634383 TAGAAGGAAAAGAATGAGAAAGG + Intergenic
1088088722 11:106012250-106012272 TTTGAGGAACAGAATTACAAGGG - Intronic
1088381876 11:109201841-109201863 TGGGAGGAACAGAATGAGTGGGG - Intergenic
1088502611 11:110497730-110497752 TTGGAGCAACAGGAAGAGACAGG + Intergenic
1088516502 11:110641046-110641068 TTAGATAAACAGAGTGAGCAAGG + Intronic
1088644095 11:111902552-111902574 TTGGATAAGGAGGATGAGAAAGG - Intergenic
1088697882 11:112383899-112383921 TTGGAGTAACTGAAGGAGATGGG + Intergenic
1089133623 11:116231950-116231972 TTGTTTAAATAGAATGAGAATGG - Intergenic
1090332338 11:125941853-125941875 TTGGAGCAGCAGCATGTGAAAGG - Intergenic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1090717216 11:129441138-129441160 TGGGACAAGTAGAATGAGAAAGG - Intronic
1090827618 11:130398847-130398869 TAACAGAAACAGAAGGAGAAAGG + Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091720002 12:2806016-2806038 TTGGAGAAAAAATATGTGAAAGG + Intergenic
1092033720 12:5311965-5311987 TAGGAGAAAAAGAGTGTGAATGG - Intergenic
1092228609 12:6764789-6764811 TCAGAGAAACAGATTGAGAGAGG + Intronic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092639942 12:10494773-10494795 TTGGAGTACCAGAAGGAGACGGG + Intergenic
1092966202 12:13645864-13645886 TTTAAGTAACAGAAAGAGAAGGG + Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093224067 12:16459971-16459993 TTGTAGAAACAGAAGGTTAATGG + Intronic
1093855339 12:24094954-24094976 TTGGATAAACAAAAGGAGAGAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094067931 12:26381103-26381125 TTGGAGAGACACGATGAGAGAGG + Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1094776236 12:33731213-33731235 TTGGAGTACCAGAAAGAGACAGG - Intergenic
1095320229 12:40818283-40818305 TTGGACAACCAGAAGGAGATGGG - Intronic
1095490714 12:42731100-42731122 TGGGAGACACGGAATCAGAATGG - Intergenic
1095550990 12:43439349-43439371 TGTGAAAAAGAGAATGAGAACGG + Intronic
1095830341 12:46578982-46579004 TTTTACAAACAGAATGAGAGAGG - Intergenic
1096910863 12:54982407-54982429 TGGGAGAAAGAGTATGAAAAGGG - Intronic
1097006910 12:55926648-55926670 TTCGAGAAAAATAATGAAAACGG + Intronic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097905328 12:64913626-64913648 TAGGAAAAACAGAATGACAGAGG - Intergenic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1098403322 12:70097267-70097289 TTGAAATAACTGAATGAGAAGGG - Intergenic
1098696494 12:73563778-73563800 TTGGAGAAAAATAATGTAAATGG - Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099224208 12:79949566-79949588 ATGGAGAAATAGAAAAAGAAAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100608656 12:96172199-96172221 GTGGTAAGACAGAATGAGAATGG - Intergenic
1101205733 12:102485284-102485306 TTGGAGATTCAGGATCAGAAAGG - Intergenic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101273346 12:103171998-103172020 TTGGAGAACCAGAATGAATTAGG + Intergenic
1101317995 12:103646968-103646990 TGGGACAAACAGGCTGAGAAAGG + Intronic
1101593355 12:106141414-106141436 TTGAAGAAACCGTATCAGAAAGG + Intergenic
1104256238 12:127141916-127141938 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1104467649 12:129003835-129003857 TTGGAGGAACAGGAGAAGAAGGG + Intergenic
1105828464 13:24143319-24143341 TGGGAGAAGTAAAATGAGAAAGG - Intronic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106063282 13:26317050-26317072 TATGAGGAACAGAAAGAGAAAGG + Intronic
1106095848 13:26642513-26642535 TGGGAAATACAGAAGGAGAAAGG - Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106523962 13:30523465-30523487 TTGGAGTTACAGAGTGAGATAGG + Intronic
1106602887 13:31202084-31202106 TTGCTGAAACAGAATGTGACAGG + Intronic
1106793024 13:33175509-33175531 CTGGAGAAACTGAATTAGAGAGG - Intronic
1106889981 13:34234833-34234855 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1109129068 13:58557641-58557663 GTGGAGTAACAGAAAGAAAATGG - Intergenic
1109267703 13:60219988-60220010 TTGGAGAAAGTGAAAGTGAAGGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109492940 13:63127146-63127168 TTGTAGAAGCACAATGACAATGG - Intergenic
1111147710 13:84206082-84206104 TTTGAGAAGAAGAATGGGAAAGG + Intergenic
1111317208 13:86578204-86578226 GTGGAGAAACAGAAAAAAAAAGG - Intergenic
1111568812 13:90051329-90051351 TGGGAGAAAGAGAAAGATAAAGG - Intergenic
1111659286 13:91189498-91189520 ATGGAGTAACAGAGAGAGAAAGG + Intergenic
1111847969 13:93535350-93535372 TTGGAGAAATTGAAACAGAAAGG + Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1112824055 13:103371387-103371409 TGGGAGGAAAAGAATGAGATTGG + Intergenic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1113585121 13:111459637-111459659 AGGGAGAAAGAGAAAGAGAAGGG + Intergenic
1113757730 13:112825322-112825344 GTGAAGAAACAGAATAGGAAGGG - Intronic
1114706123 14:24728043-24728065 TTGGAGTACCAGAATTAGATGGG + Intergenic
1114928264 14:27432933-27432955 AGAGAGAAACAGAATGATAAAGG + Intergenic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115664418 14:35532929-35532951 TTGGAGAAAAAGACTGACAGAGG - Intergenic
1115775641 14:36711899-36711921 TTAGAAAAACATAATTAGAAAGG - Intronic
1115841666 14:37478346-37478368 TTGCAGAAACAGAAAAAGAATGG + Intronic
1115885456 14:37966780-37966802 TTTGATAAACATAATCAGAAAGG - Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116312048 14:43340200-43340222 TAGGAGAAAGAGAAGAAGAAAGG + Intergenic
1116560767 14:46376210-46376232 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1117670099 14:58097926-58097948 TTGGTGAAACAAAATGAAATTGG - Intronic
1118122873 14:62865671-62865693 TTTGAAAAAAAGAATTAGAAAGG - Intronic
1118177741 14:63458904-63458926 TTGGAGAAATAGAAGTAAAAGGG - Intronic
1118479062 14:66145190-66145212 TTGGAGTAACCGAAGGAGATGGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1120017205 14:79487554-79487576 TTGGGGAAACAGGAAGAAAAAGG - Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120802578 14:88708483-88708505 TTGAAGAAAGAGAAAAAGAAAGG + Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1121714742 14:96065578-96065600 TTGGAGGAAGAGAGAGAGAAGGG - Intronic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1123431906 15:20225178-20225200 TTGAAGAAAGGGAATGGGAAAGG - Intergenic
1124046384 15:26154613-26154635 TTGGAGTACCAGAAAGAGATGGG - Intergenic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124236224 15:27991525-27991547 TTAGAGAAACAGAAAGATCAGGG + Intronic
1124565447 15:30808350-30808372 TTTGAGAGACAGAGAGAGAATGG - Intergenic
1125146061 15:36470011-36470033 TTGAAGAAAAAGATTGAAAAGGG - Intergenic
1125815714 15:42582175-42582197 TAGGAGAAACACAGTGAGACAGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126256563 15:46634058-46634080 TTTGTAAAACAGAATGTGAACGG - Intergenic
1126296246 15:47139053-47139075 TTAGAGAAAGAGAATCAGCAAGG - Intergenic
1126525429 15:49648996-49649018 TAGGAGTAACAGAATGGGAAAGG + Exonic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126824287 15:52533510-52533532 TTGGAGGTACAGGATGAGAGGGG - Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127239187 15:57092517-57092539 TTTGAGACAGAGAAGGAGAAAGG - Intronic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1127358362 15:58223482-58223504 TTCTAGAAAAAGAAAGAGAAAGG - Intronic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128352893 15:66903235-66903257 TGGTAGAAACAGAATGAGCTGGG + Intergenic
1128826368 15:70721223-70721245 TTCTAGAAACAGAATGGGAATGG - Intronic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129663437 15:77566136-77566158 GTGTAGAAAGAGAAAGAGAAAGG + Intergenic
1129952934 15:79607887-79607909 TTTGAAAAACACAATGAGAAAGG + Intergenic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1130435808 15:83898293-83898315 TTGAAGAAAAAGAAGAAGAATGG + Intronic
1130515119 15:84620604-84620626 TTTGAGATACAGAGTGAAAATGG + Exonic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1133399753 16:5476865-5476887 TGGGAGAACTAGATTGAGAAAGG - Intergenic
1133543747 16:6785185-6785207 CTGGAGAAAAAAAATGACAAAGG + Intronic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1133595120 16:7283555-7283577 ATGGAGATACAGAATGTCAAGGG - Intronic
1133874711 16:9722982-9723004 TTGGAGAAAGAGGATGGGAGGGG - Intergenic
1133887515 16:9844347-9844369 TTGGGGACACAGGATGAAAAAGG + Intronic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1134264919 16:12684586-12684608 TTGGAGGAAACGAATGAGCAGGG - Intronic
1134306046 16:13033452-13033474 TTAGAGAAGCAGAAAAAGAAAGG - Intronic
1134654480 16:15937720-15937742 TTTGAGAAAATGAATGAGAGAGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135249311 16:20887498-20887520 TTAAAGAAACAGACTGAGAGGGG + Intronic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135823087 16:25702141-25702163 TTAGAAAAACAAAAGGAGAAAGG + Intronic
1135857735 16:26027523-26027545 TTGGAGAAGCAAAATGAGATAGG - Intronic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1138011112 16:53380973-53380995 TTGAAGAAATGGAAGGAGAAAGG - Intergenic
1138021722 16:53489463-53489485 TTGGAGAAACTGAATGCTAAAGG + Intronic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138269882 16:55687949-55687971 ATGTAGAAACACAATGAGAGAGG + Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138785891 16:59845968-59845990 TGAGAGAAGCAGAATGAAAAAGG - Intergenic
1138914743 16:61450088-61450110 TTGGAGAAAAAGCAATAGAAGGG - Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139209979 16:65067849-65067871 TTGGAGAAAGGGAGGGAGAAAGG + Intronic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140583321 16:76256685-76256707 TTTGAGAAAGAGAAAGTGAATGG + Intergenic
1140820709 16:78660362-78660384 TTGGGGAAACAGAAGGAAATTGG + Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144071693 17:11679706-11679728 TTCGAGAAGTAGAACGAGAATGG + Intronic
1144365264 17:14537787-14537809 TTGGACAATCGGAATGTGAAAGG + Intergenic
1144556620 17:16288053-16288075 TTGGAGAAAGACACAGAGAAAGG - Intronic
1146609555 17:34292244-34292266 TTGGACATACAGAATGACTAAGG - Intergenic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1146976374 17:37116310-37116332 TAGGAGAGACAGCATGAGACTGG + Intronic
1147037778 17:37694523-37694545 TTGGAGGAACAGAAGAAGACAGG + Intronic
1147210288 17:38869433-38869455 GTGGTGTAACAGAAGGAGAAAGG + Intergenic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1147499973 17:40953619-40953641 TTGGAGAAGGAAAAAGAGAAAGG + Intergenic
1147870384 17:43582965-43582987 GTTTAGAAACAGAATGGGAATGG - Intergenic
1147907803 17:43833906-43833928 TTGCAGAACCAAAATAAGAATGG - Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149290148 17:55210068-55210090 TGGGAGAGAAAGAAGGAGAATGG + Intergenic
1149586383 17:57790404-57790426 TTTGTGAAACAGAAAGAGATTGG + Intergenic
1151002542 17:70394802-70394824 TTGGAGAAAAAGTAAGACAAGGG - Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151510370 17:74555263-74555285 CTCAGGAAACAGAATGAGAAGGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151759655 17:76093369-76093391 TTGGAGAAACAGGCAGAGCAGGG - Intronic
1153175053 18:2362335-2362357 TTTGAGAAACAAAAAGAAAAAGG - Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1154078422 18:11229046-11229068 TGGGGGAAACAGGAAGAGAAGGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154124143 18:11674633-11674655 GTGGAGCAAGAGAAAGAGAAAGG + Intergenic
1154452856 18:14492216-14492238 TTGTAGAGACAGAAATAGAATGG + Intergenic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1156236912 18:35214496-35214518 TTTGAGAAACAGAAAGAAAAAGG - Intergenic
1156529834 18:37804847-37804869 TTGGAGAACCTGAAAGAGACAGG - Intergenic
1156664731 18:39391295-39391317 TTGGAGAACCTGAAAGAGATGGG + Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157732249 18:50014256-50014278 ATGGAGAAAATGGATGAGAAAGG + Intronic
1157909512 18:51602291-51602313 TTGGAGAACAGGCATGAGAAGGG - Intergenic
1159345130 18:67192271-67192293 ATGGAGAAACAAAAAGAGATGGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159851321 18:73530075-73530097 ATGGACAAAAAGAATAAGAAAGG + Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1162611993 19:11763115-11763137 TTGGTTAAACAGAAAGAGAAGGG + Intergenic
1164550130 19:29203786-29203808 TTGGAAAAACTTACTGAGAAAGG + Intergenic
1164676431 19:30104666-30104688 TGGGAGAAACAGAAGGTGAGAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166290258 19:41858959-41858981 TTTTAGAAACAGTATGAGATAGG + Intergenic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1167631291 19:50627805-50627827 ATGGAGAGAGAAAATGAGAAGGG + Intronic
1167636913 19:50660475-50660497 TAAGAGAATCCGAATGAGAATGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
925281011 2:2684696-2684718 TGGGAGAAAAAACATGAGAATGG - Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925447338 2:3939487-3939509 TTGGAGTACCAGAAGGAGACAGG - Intergenic
925562675 2:5214677-5214699 TTAGAGACACAGGGTGAGAATGG - Intergenic
925749760 2:7077378-7077400 TTGGAGAAAAAGGAGCAGAAAGG + Intergenic
925818883 2:7779586-7779608 TTAGAGAAACAGAACCAGTAGGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
926055509 2:9771686-9771708 TTTGAGAAACCCAGTGAGAAGGG + Intergenic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
928207469 2:29296395-29296417 GGGGAGAAACAGAATCAAAACGG - Intronic
928368929 2:30724840-30724862 TTTGATGAACAGAATGAGATTGG + Intronic
928688474 2:33775007-33775029 GAGGAGAAACAGAATGCAAAAGG - Intergenic
928936266 2:36681764-36681786 TTCCAGAAATAGAAGGAGAAAGG + Intergenic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
929988470 2:46762845-46762867 ATGAAGAAAATGAATGAGAATGG - Exonic
930222213 2:48756125-48756147 TTGGTGAAAGAGAAGGGGAAAGG - Intronic
930559318 2:52940637-52940659 TGGTAGAAACAGAATGATAATGG - Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931124104 2:59254417-59254439 TTAGGATAACAGAATGAGAATGG + Intergenic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
931674770 2:64683366-64683388 TTGGAGAAAAAGAAAGAGATAGG + Intronic
932378120 2:71256187-71256209 GAGAAGATACAGAATGAGAAGGG + Intergenic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
932822079 2:74909989-74910011 ATCGAGAAAAAGAGTGAGAAAGG - Intergenic
932840830 2:75080949-75080971 TAGAAAAGACAGAATGAGAATGG + Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933002700 2:76945917-76945939 GTGAAGAACAAGAATGAGAAGGG - Intronic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933335251 2:80949894-80949916 GTAGGGAAACAGATTGAGAAAGG - Intergenic
933505350 2:83170328-83170350 TAGGAAAAAAAGAAGGAGAAGGG - Intergenic
933534638 2:83556907-83556929 TTCGAGTAACTGAAAGAGAAAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934053883 2:88235426-88235448 TTAGAGTAAAACAATGAGAATGG + Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935209369 2:100925279-100925301 TTGCAGAAACACAATGGTAAAGG + Exonic
935319498 2:101872042-101872064 TTGGATAAAAAGAATGAAAAAGG - Intronic
935536864 2:104304959-104304981 TTGAAGAAAAGGCATGAGAAGGG - Intergenic
935662199 2:105476699-105476721 TTGAAAAAACAGAATGATAATGG + Intergenic
936029792 2:109062096-109062118 GGAGAGAAACAGATTGAGAAGGG - Intergenic
936084090 2:109454666-109454688 TGGGATAAACAGAATGAAACAGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937805286 2:126134879-126134901 TTGGCAAAAAAGAATTAGAAAGG + Intergenic
938504840 2:131868513-131868535 TTTGAGAAACAGAAGGACCAAGG - Intergenic
938703505 2:133899858-133899880 CCGGAGAAACAGAATGTGAGTGG - Intergenic
939232134 2:139442130-139442152 TTTAAGTAACAGGATGAGAAAGG - Intergenic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939876057 2:147579388-147579410 TTAGAGAAAGAGTAAGAGAATGG - Intergenic
940504513 2:154535811-154535833 TTGAATAAAAAGAATGAAAAAGG + Intergenic
940803078 2:158154476-158154498 TTGGCGAAAAAGAAAGAAAAGGG + Intergenic
941254921 2:163217017-163217039 TTGCAGAAACAGAAAAAAAAGGG + Intergenic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942069318 2:172301183-172301205 TGGAAGAAAAAGAAAGAGAAGGG - Intergenic
942626228 2:177903476-177903498 TTGGATAGACAGCATGTGAAGGG + Intronic
943394397 2:187314726-187314748 TTGAAGAAAGAGAAAGAGAGAGG - Intergenic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
943629652 2:190236934-190236956 TTGGGGAAAGAGTATGATAAAGG - Intronic
943869250 2:192972969-192972991 TAGAAGAAACACCATGAGAAAGG - Intergenic
943937870 2:193946841-193946863 TTGGATATAGAGAATGAGAGAGG - Intergenic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946294648 2:218774244-218774266 TAGGAGAGACAGAGAGAGAAAGG + Intergenic
946471294 2:219963672-219963694 TTGCAGAAAAGGAAAGAGAAAGG - Intergenic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
946963185 2:225006694-225006716 TTGGAGAAATAAAAGGAGCAAGG + Intronic
946978396 2:225178439-225178461 GTGAAGAAACGGAATGAGAAGGG - Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169158373 20:3353963-3353985 TTGGAAAAATAGAATGTGCATGG - Intronic
1169363522 20:4971963-4971985 TTTGAGAAACAGAATGTGACCGG - Intronic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170369175 20:15629989-15630011 GGGAAGAAAAAGAATGAGAACGG - Intronic
1170991384 20:21304551-21304573 GTGGAGAAATGGGATGAGAAGGG - Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172367364 20:34360331-34360353 CTAGAGAAACTGAATGAGGATGG + Intergenic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173361810 20:42351236-42351258 TTGGAAAAACTGAATTAAAAAGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1173657904 20:44713843-44713865 TTGGAGGAAAAGAAACAGAAGGG - Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1173897781 20:46563737-46563759 TTAGAGAGACAGAGAGAGAAAGG + Intronic
1174376281 20:50128708-50128730 TTGCAGGAACAGACTGAGACAGG - Intronic
1174853810 20:54023571-54023593 TTTGATAAACAGAGAGAGAAAGG + Intronic
1174924726 20:54746594-54746616 TTGGGGAAACAGGATGATTATGG - Intergenic
1175127861 20:56765781-56765803 TTGAACAAACAAAATAAGAACGG + Intergenic
1175568512 20:60000236-60000258 GTGTGGAAACAGAATTAGAAAGG + Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1177438795 21:21090844-21090866 TTTGAGAAACAGATTGGGATAGG - Intronic
1177629450 21:23707420-23707442 GCAGAGAAATAGAATGAGAATGG - Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1179265625 21:39800020-39800042 TTGGTGAAACAGAATGAATTTGG + Intronic
1179286106 21:39978554-39978576 TGGGAGAGACAGCATGAGCAGGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182155134 22:28064380-28064402 TTGGAAACACAGAATCAGAGAGG - Intronic
1182388413 22:29967964-29967986 ATGGACAAACAAAATGTGAATGG - Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182921790 22:34087100-34087122 TGGGAGAAACAGAAACAGATGGG - Intergenic
1183878847 22:40808868-40808890 TGAGAGAATAAGAATGAGAAAGG - Intronic
1184003815 22:41694448-41694470 TGGGAGAACCAGGATAAGAATGG + Exonic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949466066 3:4345059-4345081 TTGGAGTACCAGAAGGAGACAGG + Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
951514097 3:23538987-23539009 TAGGAAATACTGAATGAGAAAGG + Intronic
951908748 3:27728621-27728643 TGGGAAAAACAGAATGCTAATGG - Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953824510 3:46239184-46239206 TTGGAGAAAAACAAAGAGGACGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956319333 3:67978940-67978962 ATGGAGAAACAAGAAGAGAATGG - Intergenic
956502163 3:69898664-69898686 TTGGAGAACCAGGATGGTAAAGG + Intronic
956544813 3:70389091-70389113 TGGAAGAAACAGAAAGGGAATGG - Intergenic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956780010 3:72596283-72596305 TTGGAGGAATAGACTGAGCAGGG + Intergenic
957165514 3:76668277-76668299 TTGTAGAGAGAGAAAGAGAAAGG + Intronic
957291507 3:78282833-78282855 TTGGAGTATCAGAAGGAGACAGG + Intergenic
957394882 3:79623721-79623743 TTGGAGTACCAGAAGGAGATGGG + Intronic
957933522 3:86912985-86913007 TTGGAGAAACAGAATGACACTGG + Intergenic
958054197 3:88388020-88388042 TTGGGGAAACACTATGGGAAAGG - Intergenic
958073092 3:88640006-88640028 TTGGAGTACCAGAAGGAGACAGG - Intergenic
958656326 3:97008221-97008243 TTGGAGTACCAGAAGGAGACAGG - Intronic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
959205689 3:103303803-103303825 TTGGAGTACCAGAAGGAGACAGG - Intergenic
959582691 3:107998160-107998182 TTGGAGTAAAAATATGAGAAGGG + Intergenic
959805806 3:110552133-110552155 TGAAAGAAACAGAATGACAAAGG + Intergenic
959825279 3:110787271-110787293 TTGCAGAGACACAATGAAAAAGG - Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960247821 3:115418886-115418908 TGAGAGAAAGAGAACGAGAAGGG + Intergenic
960413885 3:117360258-117360280 TTGGAGTACCAGAAGGAGATGGG + Intergenic
960477111 3:118143898-118143920 TTGGAGTACCAGAAGGAGATGGG - Intergenic
961945397 3:130681932-130681954 TGGCAGGAACAGACTGAGAATGG + Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962493705 3:135918919-135918941 TGAGAGAAACAGAAGGATAAAGG + Intergenic
962692098 3:137908819-137908841 TTGGAGTACCAGAAGGAGACCGG + Intergenic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964658234 3:159091756-159091778 TTTGAGTATCAGAATGATAATGG + Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966263735 3:178012320-178012342 TTCAAAAAAAAGAATGAGAAAGG + Intergenic
966415637 3:179686909-179686931 TTGGTGAAAGAAACTGAGAAAGG - Intronic
966652204 3:182314249-182314271 TTGGAGTACCTGAAAGAGAAGGG - Intergenic
966723033 3:183083586-183083608 TTGCTGTAACACAATGAGAAAGG - Intronic
966743975 3:183258311-183258333 TGGGAGAAAGAAAAGGAGAAGGG - Intronic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967682312 3:192378665-192378687 TTGGAGAAAAAGGATTAAAATGG - Intronic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
969871349 4:10106996-10107018 TTGGGGAAGAAGAATGAGATTGG + Intronic
969885163 4:10208980-10209002 TCCGAGAAACAGCATTAGAACGG - Intergenic
970017298 4:11526256-11526278 TTGGAGAGTAAGAATAAGAAGGG + Intergenic
970099043 4:12499729-12499751 TTGGAGAAACAGATAGTTAATGG - Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971587444 4:28422199-28422221 TGGGAGCAAGAGAAAGAGAAGGG + Intergenic
971876322 4:32313571-32313593 TTGCAGACACAGAAGGACAATGG + Intergenic
972597973 4:40546892-40546914 TTGGAGTGATAGAATGAAAAAGG + Intronic
973196763 4:47453372-47453394 TTTGAAGAACAGAAAGAGAAAGG + Intronic
973207772 4:47579637-47579659 TTTGAGGAAAAGAATGAAAAAGG + Intronic
973276649 4:48317417-48317439 GTGGACAAACAAAATGATAAAGG - Intergenic
973722716 4:53741606-53741628 TTGGAGAAAGAAAACGAGAGAGG + Intronic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974692764 4:65320458-65320480 TAGGAAAAACAAAATGAGAAAGG + Exonic
974768815 4:66384067-66384089 TTGGAGTACCAGAAGGAGACTGG + Intergenic
975108289 4:70594565-70594587 TTAGAGAAAGAGAATGGAAATGG + Intronic
975201557 4:71596249-71596271 TTGGAGAGAGAGAAAGGGAAGGG + Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
977892362 4:102326849-102326871 TAGGATAACCAGGATGAGAAGGG - Intronic
978187531 4:105874727-105874749 TTGGCAAAAAAGAAGGAGAATGG - Intronic
978349319 4:107804790-107804812 TCGGTGGAACAGAATGAGCAAGG + Intergenic
978773845 4:112486079-112486101 TTTGTTAAACAGAATGAGAGAGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979116504 4:116830780-116830802 TTGGAGTAACTGAAAGAGATGGG + Intergenic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
979197681 4:117940348-117940370 TTGGAGTATCAGAAGGAGATGGG - Intergenic
979463725 4:121012396-121012418 TTGGACCAAAAGAAAGAGAAAGG - Intergenic
979775594 4:124584595-124584617 TTGGAGTACCAGAAGGAGATGGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980367832 4:131829073-131829095 TTGGGGAAAGAGAAGGAGATTGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981119318 4:141030764-141030786 TTATAGAAACAGAATCAGAATGG + Intronic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
982201740 4:152968197-152968219 TTGGAGAAAAAAAATATGAATGG - Intronic
982335206 4:154228857-154228879 TTGCAGAAACAAAAGAAGAAGGG - Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982528931 4:156513809-156513831 TTGGAGATCCAGGCTGAGAAAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983299614 4:165908660-165908682 TTGGAGATACAGAGTCAGAGAGG + Intronic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
983924480 4:173385107-173385129 TTGCAGCAACTGAATGAGATAGG - Exonic
984194198 4:176639050-176639072 TGGGAGTAAGAGAATGAGATAGG + Intergenic
984492044 4:180446696-180446718 TGGCAGAAACAGAATAAAAATGG - Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
984625950 4:182008350-182008372 TTGGAGTACCAGAAGGAGATGGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985403184 4:189612309-189612331 TGGGAGAAAAAGAAGAAGAAAGG - Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986774976 5:11006154-11006176 TTGGCAAAAAAGACTGAGAAGGG + Intronic
986878669 5:12142783-12142805 TTGGAGAAACAAAATGTCAGAGG + Intergenic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
988247243 5:28702798-28702820 TTGGAGAAAGATAAAGAAAAAGG - Intergenic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
989529630 5:42492696-42492718 TTGGAGAAATAGATTTGGAATGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989685121 5:44076532-44076554 TTGGAGGATCAGAAAAAGAATGG - Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990715376 5:58630659-58630681 TGGGAGAAAGACAATGAGAAAGG + Intronic
990804291 5:59640876-59640898 ATGGAGTTACAGAATGATAATGG - Intronic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
992321477 5:75617305-75617327 TTGGAAAAACAGAACCACAAAGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992795834 5:80254680-80254702 AGAGAGAAAGAGAATGAGAATGG - Intronic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
993570543 5:89533427-89533449 TGGGACAGAAAGAATGAGAAGGG + Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
994168096 5:96629008-96629030 TGGGAGAAACTGAACGAAAATGG - Intronic
994910036 5:105892405-105892427 TTGGATAAACAGAAAGATATAGG - Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995891523 5:116958129-116958151 TTGGGGAAAAAAAAAGAGAAAGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998131359 5:139652994-139653016 ACGGAGATACAGAAAGAGAAAGG - Intronic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
998397799 5:141830375-141830397 TTAGAGAAACAGAGGGAGAGAGG - Intergenic
998678654 5:144439230-144439252 TTGGAGAAATACAATGATGAGGG + Intronic
1000440786 5:161260632-161260654 CTGGGGAAACAGAATAAAAATGG + Intergenic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1001148083 5:169202533-169202555 TTAGAGAAGCAGAATGGCAAGGG - Intronic
1001197872 5:169690013-169690035 TTATGGAAACAGGATGAGAAAGG - Intronic
1002941630 6:1721873-1721895 TTTCAGAAACAGGATCAGAAAGG + Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003431996 6:6047492-6047514 ATGGAGAGACTAAATGAGAAGGG + Intergenic
1003686942 6:8313943-8313965 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1003709612 6:8574845-8574867 AGGGAGAAAGAGAAAGAGAAAGG - Intergenic
1003792712 6:9565120-9565142 TTGGAGAAAGAAAATAAGGAAGG - Intergenic
1004321523 6:14635174-14635196 GTGGAGAGAGAGAATGAGAGAGG - Intergenic
1004347642 6:14863364-14863386 TTGGAAAAACAGAAACAGAGAGG + Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1005354102 6:24966039-24966061 TTAGAAAAACAGAATGAGATTGG + Intronic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005489490 6:26334043-26334065 TTTGACCAACAGAAAGAGAAAGG - Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1006357692 6:33570056-33570078 GTGGAGAGAGAGAAAGAGAAGGG - Intergenic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1007801098 6:44394059-44394081 TTGAAGAAACAGAAGATGAAGGG - Intronic
1007875036 6:45088371-45088393 TTGGAGTAACAGAGTGTCAAAGG - Intronic
1008468095 6:51853539-51853561 TTGGAGTACCAGAAGGAGACAGG - Intronic
1008661353 6:53671325-53671347 TTGTTGAAACAGAATGCAAACGG - Intergenic
1008702532 6:54118003-54118025 TTGATGAAAGAAAATGAGAAAGG + Intronic
1008773485 6:55007997-55008019 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1008862884 6:56171968-56171990 TTAGAGAAACAAAAAGAAAAAGG + Intronic
1008961011 6:57265459-57265481 TTGGAGGAACAAAATTAAAATGG - Intergenic
1008986229 6:57546425-57546447 TTGGAGAAAGTGAATGACATGGG + Intronic
1009661521 6:66618140-66618162 TTTGAGAAACAAAAAGAAAATGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010849379 6:80752899-80752921 TAGGAAATACAAAATGAGAAGGG - Intergenic
1011106334 6:83785831-83785853 TGGGAGAGAAAGAAGGAGAAGGG + Intergenic
1012097793 6:94986561-94986583 ATCGAGAGACAGAACGAGAAAGG + Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1013017122 6:106169970-106169992 TGGGAGAACCAGATTGACAATGG + Intergenic
1013416191 6:109926784-109926806 TTGGAGCAACAGGATGAGCCTGG + Intergenic
1013461683 6:110380105-110380127 TTGGAGTACCAGAAAGAGATAGG + Intergenic
1013632888 6:112002064-112002086 TTGGAGAGGCAGACCGAGAATGG + Intergenic
1014367396 6:120561821-120561843 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1014543984 6:122710934-122710956 TGGGAAAAAAAGAATGAGAAGGG + Intronic
1014595886 6:123338281-123338303 TTAGAGAAACAGAGAGAGAATGG + Intronic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1014886093 6:126783414-126783436 TGAGAGAAAGAGAAGGAGAAGGG - Intergenic
1015072106 6:129106957-129106979 CCAGAGAAACTGAATGAGAATGG + Intronic
1015091297 6:129362509-129362531 TTGGACAAAGAGAATGGCAAGGG - Intronic
1015358343 6:132306388-132306410 TTGGAGTACCAGAAGGAGATGGG + Intronic
1015446604 6:133312829-133312851 ATGGAAAAAAAAAATGAGAAGGG - Intronic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015713702 6:136168591-136168613 TTGAAGAAAAACAATGAAAAAGG + Intronic
1016064280 6:139662854-139662876 CTTGAGACACAGAATTAGAAGGG + Intergenic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1016917813 6:149261059-149261081 TTGGAGAAAGTGGATGAAAAAGG - Intronic
1017229165 6:152053503-152053525 TGAGAGAAAGAGAAAGAGAATGG - Intronic
1017759723 6:157558667-157558689 GTGGAAAAACAGAATCATAAGGG - Intronic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1018082874 6:160273758-160273780 TTGGAACAAATGAATGAGAAAGG + Intronic
1018570274 6:165202781-165202803 TTGGAGAAAAAAAAAGAGATAGG + Intergenic
1018792336 6:167158007-167158029 TTGGGGAAAGAGGATGAGCAGGG + Exonic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020621948 7:10529134-10529156 TTGGAGTACCAGAAGGAGACAGG + Intergenic
1020672081 7:11128724-11128746 TGGGAGAGACGGAAGGAGAACGG - Intronic
1020883868 7:13798220-13798242 TTAGAGAAAAAGAATCAGAGTGG + Intergenic
1021085121 7:16413476-16413498 TTAGAGATTCAGAATGAGAAAGG - Intronic
1021432672 7:20578723-20578745 TGGGAGAAGCTGAATGAGAAAGG - Intergenic
1021439596 7:20662802-20662824 TTTGAGAATCTGATTGAGAAAGG + Intronic
1021489778 7:21207016-21207038 GTGGAGACACATCATGAGAAGGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1023363548 7:39440299-39440321 CTGGAGTACCAGAATGAGATAGG - Intronic
1023595221 7:41822608-41822630 TTGGAAAAACAGAATGAAAAGGG - Intergenic
1024773996 7:52760984-52761006 TTAGAGAAGCAGAATTTGAAAGG + Intergenic
1024920916 7:54553853-54553875 TTGGAGACACTGGATGAGACAGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1028262473 7:88683462-88683484 TAGGAAAAACAGAACTAGAAAGG - Intergenic
1028443913 7:90896319-90896341 TTGAAGAGAGAGAATGAGAAAGG - Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1028865022 7:95699275-95699297 TAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1029226859 7:99034605-99034627 TTGGGAGAACTGAATGAGAAAGG + Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030278615 7:107745682-107745704 TTGGTGAAAATGAAGGAGAATGG + Intronic
1030379281 7:108793927-108793949 TTTAAGAAACAGAGTAAGAAAGG - Intergenic
1030405256 7:109102580-109102602 TTGGAGGAAAAAAATAAGAAAGG - Intergenic
1030484327 7:110147868-110147890 GTGTAGAAACAGAAAGTGAATGG + Intergenic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031038963 7:116818587-116818609 ATGGTGTAACAGAATGAGATAGG + Intronic
1031624379 7:123975240-123975262 TTTTAGAATCAGAATCAGAAAGG - Intergenic
1031837404 7:126694941-126694963 ATGGAGAAACAGAATGTAAGTGG + Intronic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1032785298 7:135195635-135195657 TGAGAGAAACACAATTAGAAAGG + Intronic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033413430 7:141141193-141141215 TTGGAGCAACAAAATAAGCAAGG - Intronic
1033543929 7:142382536-142382558 TTGGAAGAACAGGATGGGAATGG + Intergenic
1033809528 7:144994915-144994937 CTGCAGAAACAGAATCGGAAAGG + Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034132692 7:148735113-148735135 TTTGAGAATGAGAATGAGATTGG + Intronic
1035032969 7:155874499-155874521 GAAGAGAAACAGAAAGAGAAAGG + Intergenic
1035491845 7:159286049-159286071 TTGGAGTACCAGAAGGAGACAGG + Intergenic
1035599332 8:887992-888014 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1036100728 8:5781098-5781120 TTGAAGAAATCGAAAGAGAATGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036467836 8:9018192-9018214 GGGAAGAAACAGTATGAGAAAGG - Intronic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037339848 8:17832699-17832721 TTGGAGAGAGGGAATGGGAAAGG - Intergenic
1037352552 8:17976724-17976746 TGAGAAAAACAGAATGAGAAAGG + Intronic
1038305210 8:26394722-26394744 TGGGAGAATGAGAATGAAAAAGG + Intronic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1038603271 8:28970755-28970777 TTTGATAAACAGAATGGAAAAGG - Intronic
1038706767 8:29901594-29901616 TAGCAGGAACAGAATGAGATGGG - Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039351254 8:36766365-36766387 GTGGGGAACCAGAATGAAAAAGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1039685768 8:39800642-39800664 TTGGAGTATCAGAAGGAGATGGG - Intronic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1040345447 8:46488492-46488514 TTGGAAAAACAGATAGAAAAGGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040570460 8:48604881-48604903 CTGGAGAAACAGAATTAGAGTGG - Intergenic
1040634584 8:49257418-49257440 TTGGAGTCACAGCATGAAAAAGG + Intergenic
1040770544 8:50970123-50970145 TGAGAGCCACAGAATGAGAAGGG + Intergenic
1040855152 8:51941462-51941484 TTGGGGAAACATAATGAGTTTGG - Intergenic
1041318337 8:56587621-56587643 TTGGAGAACCAACATGAGAAAGG + Intergenic
1041524774 8:58792936-58792958 TGGAAGAAACAGAAAAAGAAGGG + Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1041838568 8:62244360-62244382 TGGGAGAAACCAAAGGAGAAAGG - Intergenic
1041869858 8:62620364-62620386 TTTGAGAAACAGAATGTGCATGG - Intronic
1041900963 8:62981961-62981983 TTAGAAACAGAGAATGAGAAAGG + Intronic
1042434771 8:68750712-68750734 TTGGAGAATCAGAATGCTTAGGG + Intronic
1042746138 8:72108460-72108482 TTAGAAAGACAGAATGAGAAGGG + Intronic
1042966677 8:74361086-74361108 GTGGAGAAAAAGGAAGAGAAGGG - Intronic
1043060056 8:75488760-75488782 TTGAGGAAATAGAATGAGAAAGG - Intronic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043729834 8:83662778-83662800 GTGTAGAAAGAGAATGAGACGGG + Intergenic
1044355993 8:91223791-91223813 TTGGAGTACCAGAAGGAGACAGG - Intronic
1044509927 8:93063268-93063290 GTGGAGAAAGAGAAAGAAAAGGG + Intergenic
1044784324 8:95778540-95778562 TGGGACATACAGATTGAGAAAGG - Intergenic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1045977957 8:108150594-108150616 TTGGGGTAACAGAAAGAGATGGG + Intergenic
1046260888 8:111766021-111766043 TTGGGGAACCAGAAGGAGAGTGG - Intergenic
1046268732 8:111865118-111865140 TTGGAGAATTAGCATGAGAGGGG - Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046504418 8:115118580-115118602 TTGAATGAACAGTATGAGAAAGG + Intergenic
1046588097 8:116172628-116172650 TGGGAGAATGAGAATGAAAAAGG + Intergenic
1046784609 8:118252655-118252677 TGGGAGAAAGAGAAAGAGGAAGG - Intronic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047092803 8:121592211-121592233 GTGGAGATAAAGAATGACAATGG + Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1047838652 8:128722114-128722136 TTGAAGAAACAGAATGAGAGTGG - Intergenic
1047884568 8:129234905-129234927 TTGTAGAAACACCATGAGAAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050346642 9:4695376-4695398 TCTGAGAAACAGAATGATTATGG - Intronic
1050447589 9:5741760-5741782 TGGCAGAAACAGACTCAGAAAGG - Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1051334674 9:16055093-16055115 TTAGAGAAAGAGAAGGACAAAGG + Intronic
1051427766 9:16951037-16951059 TTGGAAAGAAAGAATCAGAATGG - Intergenic
1052104425 9:24495051-24495073 TTAGGGAAAAAGAATGAGCAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1052986378 9:34491064-34491086 TGGGTGATACAGAATGGGAAGGG + Intronic
1053055471 9:34990975-34990997 TTTGAGAAAAGGAATGATAAGGG - Intronic
1053469286 9:38334500-38334522 TAGGGGAAACAGAATGAAAGAGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053627558 9:39890918-39890940 TTTGAGTAAAAAAATGAGAAAGG + Intergenic
1053778435 9:41575105-41575127 TTTGAGTAAAAAAATGAGAAAGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054216329 9:62359785-62359807 TTTGAGTAAAAAAATGAGAAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054671152 9:67795558-67795580 TTTGAGTAAAAAAATGAGAAAGG + Intergenic
1055769459 9:79701936-79701958 TTGGAGGAACAAAATGTTAAGGG + Intronic
1055800598 9:80032030-80032052 TAGGAGACAGAGAATGAGAGGGG + Intergenic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056515078 9:87342647-87342669 CTGGAGAAAGAGAAAAAGAAAGG + Intergenic
1057492360 9:95530923-95530945 GTGGAGATAATGAATGAGAATGG + Intergenic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058858641 9:109092111-109092133 CTGAAGAGAAAGAATGAGAAAGG - Intronic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1059709798 9:116857005-116857027 GTGGAGAAAAATAATGGGAAAGG - Intronic
1059746064 9:117202951-117202973 TTGGAGTACCAGAAGGAGACAGG - Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060897509 9:127226775-127226797 TTGGAGAACCAGACAGATAACGG + Intronic
1061381164 9:130258681-130258703 TTGGAGAAAAAAAAAAAGAAAGG + Intergenic
1185846121 X:3439838-3439860 TTGGAGTACCAGAAGGAGATGGG - Intergenic
1185948706 X:4406435-4406457 ATGGAGAGAGAGAATGAGAGAGG + Intergenic
1186969105 X:14820540-14820562 TAGGAGACACAGAATAAAAATGG + Intergenic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188267748 X:28098413-28098435 TTGGAGAAAGAAAGTGAAAATGG - Intergenic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1189165540 X:38857419-38857441 TTTGGGAAACAAAATGAGGAGGG - Intergenic
1189258194 X:39656692-39656714 TTGGAGAAACAGATTAAAAGAGG + Intergenic
1189838467 X:45044400-45044422 TTTCAGTAACAGAATGAAAAGGG - Intronic
1190288914 X:48978985-48979007 TTGGAGAAAGAGAACGACATGGG + Intronic
1190337986 X:49274407-49274429 TTGGAGTAACAGAAAGACCATGG - Intronic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1190774776 X:53543970-53543992 TGGGAGAAAGAGAAAGAGGAAGG + Intronic
1191051053 X:56193081-56193103 TTTGAGAACCAGAATGTGTAAGG + Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191811913 X:65197944-65197966 TTGGAGAAAAAGAGTGAACAGGG - Intergenic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1192057981 X:67792622-67792644 TTTCAGAAATAAAATGAGAAGGG - Intergenic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193048230 X:77075728-77075750 TTGGAGTAACAGAAGGAGATGGG - Intergenic
1193175407 X:78387018-78387040 TTAGAGATAAAGAGTGAGAAAGG + Intergenic
1193593863 X:83422202-83422224 TTGGAGAAGGAGAGAGAGAAGGG - Intergenic
1193780652 X:85697808-85697830 TTGGAGTACCAGAAGGAGACAGG - Intergenic
1193902056 X:87192543-87192565 TTAGAGAAACCGAAAGACAAAGG + Intergenic
1194460543 X:94161985-94162007 TTGGAAAAACAGAATCACAAAGG - Intergenic
1196038837 X:111178397-111178419 TTGAAGAAAAAGAAAGAGACAGG + Intronic
1197286924 X:124606689-124606711 TTGGAGGAATGGAATGAGCATGG + Intronic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197711547 X:129674690-129674712 ATGGAGAAAAAGAAAGAAAAGGG - Intergenic
1198007309 X:132509005-132509027 TTAGAGCAACAGAATAATAATGG + Intergenic
1198133993 X:133728520-133728542 TTGGATAAACATATTGAGTAGGG - Intronic
1198230449 X:134684099-134684121 TGGGAGAAGGAGACTGAGAATGG + Intronic
1198434303 X:136600442-136600464 TTGAAGAAATAGAATGAGTGGGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1199326733 X:146507430-146507452 TTGGAGAATCAGAAGGGGAGAGG + Intergenic
1199572067 X:149276199-149276221 TGGGATAAAAGGAATGAGAAAGG - Intergenic
1199780313 X:151052224-151052246 TTGGAGTGCCAGAATGAAAAGGG + Intergenic
1199862791 X:151816871-151816893 TAGGAGAAAGAGCAGGAGAAAGG - Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201479076 Y:14418056-14418078 TTGGAGAACAAATATGAGAAGGG + Intergenic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic
1201691607 Y:16772656-16772678 TTGAATAAACAGAATGAAATAGG - Intergenic
1201979826 Y:19894388-19894410 CTGGAGTATCTGAATGAGAAGGG + Intergenic