ID: 984689480

View in Genome Browser
Species Human (GRCh38)
Location 4:182708947-182708969
Sequence ACATTTTACTAGAAAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984689478_984689480 2 Left 984689478 4:182708922-182708944 CCAGGGAAAGTATTTTATGACTG 0: 1
1: 0
2: 1
3: 25
4: 237
Right 984689480 4:182708947-182708969 ACATTTTACTAGAAAGCAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 281
984689475_984689480 23 Left 984689475 4:182708901-182708923 CCAAGGTAAATAATTGAAACTCC 0: 1
1: 0
2: 1
3: 16
4: 233
Right 984689480 4:182708947-182708969 ACATTTTACTAGAAAGCAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984689480 Original CRISPR ACATTTTACTAGAAAGCAGT GGG Intronic
901488614 1:9583670-9583692 ACATTCTGATAGAAAGCACTGGG + Exonic
905160092 1:36025331-36025353 ACATTTCACTTGAAAGCAGGGGG - Intronic
905467106 1:38163410-38163432 CCATTGTAGTAGAAAGTAGTCGG - Intergenic
910072269 1:83231410-83231432 ATATGTTACTATAAAGCAGGTGG + Intergenic
910526199 1:88181186-88181208 ACATTCTATTAGCATGCAGTGGG + Intergenic
911490137 1:98554714-98554736 AAATTTAACTAGAAACCAGTAGG + Intergenic
912425394 1:109584180-109584202 ACGTATTACTAGATACCAGTTGG + Intronic
912574908 1:110660362-110660384 ACATTTTTCTAAAAATCAATAGG - Intergenic
913431310 1:118795222-118795244 AAATTTTACTACAAAGCTATAGG + Intergenic
914978586 1:152391172-152391194 GCATTTTAAAAGAAAGCACTGGG - Intergenic
915080611 1:153349369-153349391 ACACTTTCCAAGAACGCAGTAGG + Intergenic
915289786 1:154875766-154875788 ATATTTTACATAAAAGCAGTTGG - Intergenic
918473088 1:184895048-184895070 AAATTTTACTTGAAAGTAGAGGG - Intronic
918534261 1:185557142-185557164 TTATTTAACTAGTAAGCAGTTGG + Intergenic
918599278 1:186335271-186335293 ACATTTTACTTGAAAGTGCTTGG - Intronic
919448294 1:197737934-197737956 AAATTTTATTAGAAAGGAGAGGG + Intronic
920754477 1:208716041-208716063 ACATTAAACTAGCAAGCAGGAGG + Intergenic
921596174 1:217055871-217055893 ATATTTTACTAGAAAAGAGAGGG - Intronic
921832149 1:219740146-219740168 ATATTTTTATAGTAAGCAGTTGG - Intronic
924845494 1:247765587-247765609 AGGTTTTAGAAGAAAGCAGTGGG - Intergenic
1062765059 10:55585-55607 AAATTTTACAAGAAAACACTGGG - Intergenic
1063517178 10:6708247-6708269 GCATTTTAATAGAAAGTGGTGGG + Intergenic
1063733695 10:8727967-8727989 ACATTTTATTCCAAATCAGTTGG - Intergenic
1064585824 10:16838352-16838374 ACATTTTACTGGAATGAACTGGG + Intronic
1065420798 10:25541886-25541908 ATATTTGACTAGGAAGCAGGGGG + Intronic
1065700325 10:28419007-28419029 ACATTTTAATAGCAAAAAGTTGG - Intergenic
1066573655 10:36801994-36802016 ACATTCTCCAAAAAAGCAGTAGG - Intergenic
1069258888 10:66369086-66369108 ACATTTTGCAAGATAGCACTGGG + Intronic
1069834230 10:71298643-71298665 ACATTTTACTAGAAATGAATAGG + Intronic
1070354295 10:75624725-75624747 ACCTATTACTTTAAAGCAGTGGG + Intronic
1070901374 10:80032419-80032441 CCAGTGTCCTAGAAAGCAGTTGG + Intergenic
1072479424 10:95796485-95796507 ACATTTTACTATAAGGCAGGAGG + Intronic
1074621305 10:115125937-115125959 TCATTTTACTAGATTTCAGTTGG + Intronic
1074760241 10:116662084-116662106 AGGTTTCACTAGACAGCAGTGGG - Intergenic
1074923454 10:118043735-118043757 ACAGTTTTCTAAAAAGCACTTGG + Intronic
1076947056 10:133658610-133658632 ACATCCCACCAGAAAGCAGTGGG - Intergenic
1078000790 11:7493834-7493856 ACATATTTCTAGAATTCAGTTGG - Intronic
1079624415 11:22598624-22598646 TCATTTTAATAGAAACTAGTTGG + Intergenic
1079826198 11:25197911-25197933 ACAACTTACTAGAAAACATTAGG + Intergenic
1080000042 11:27336809-27336831 ACAGTTTATTAGGAATCAGTAGG - Intronic
1080127174 11:28749670-28749692 AAATTTCAATAGAATGCAGTGGG + Intergenic
1082619217 11:55399964-55399986 ACATTTTACCAGACAGCATCAGG + Intergenic
1083101501 11:60311375-60311397 ATATGTGATTAGAAAGCAGTAGG + Intergenic
1084416972 11:69038118-69038140 ACAGTTTATTAGAAACCACTCGG + Intergenic
1085501223 11:77026672-77026694 TCATTTTTCTAGAAAATAGTAGG + Exonic
1087069000 11:94056579-94056601 ACATTTTACCAGAATTTAGTTGG - Intronic
1087971190 11:104486946-104486968 AGATTATACAAGAAAACAGTAGG + Intergenic
1088171367 11:107001109-107001131 ACTTTATACAAGAAAGAAGTTGG + Intronic
1091576983 12:1746781-1746803 ACATTTTACGAGACTGAAGTGGG + Intronic
1092665672 12:10794154-10794176 ATATGTTTCTAGAATGCAGTGGG - Intergenic
1095274086 12:40258905-40258927 TCACTTGACTAGAATGCAGTAGG - Intronic
1095929296 12:47609598-47609620 CTGTCTTACTAGAAAGCAGTGGG - Intergenic
1096440027 12:51633637-51633659 ACATTAAACTTGAAGGCAGTTGG + Intronic
1096595668 12:52693466-52693488 ACATTAGACTAGGAAGCAGATGG - Intronic
1097148141 12:56955751-56955773 ACATTTTTATAGAAAGCACAGGG + Intronic
1097742489 12:63260326-63260348 ATATATTACTGGAAAGCAGTGGG - Intergenic
1099252451 12:80272912-80272934 ACATTTTAGTAAAAAGGAGAAGG + Intronic
1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG + Intergenic
1099948209 12:89269660-89269682 ATATTATAATAGAAAGCAGTAGG + Intergenic
1103429703 12:120872675-120872697 ACAATCTACTGGAAAGCAATAGG + Intronic
1105286542 13:19008923-19008945 ACAGGGTACTAGAAAGAAGTAGG - Intergenic
1105560991 13:21490572-21490594 ACATTTACCTTGAAAGCAGCTGG - Intergenic
1106096651 13:26651466-26651488 ACATTGGACCAGAAAACAGTGGG + Intronic
1107450008 13:40499919-40499941 CCCTTTTACTGGAAAGCTGTGGG - Intergenic
1107613265 13:42138315-42138337 CCATCTTTCTAGAATGCAGTTGG + Intronic
1108278890 13:48840946-48840968 ATATTTTTCTAGAAAGGATTTGG - Intergenic
1108830827 13:54476171-54476193 ATTTTTTACTAGAAATCAGGGGG - Intergenic
1109558123 13:64008082-64008104 ACATTTTATTATAAAGATGTGGG + Intergenic
1109836476 13:67863827-67863849 ATATTTAACCAGAAGGCAGTGGG + Intergenic
1109937621 13:69312219-69312241 ACATTTCAGAAGACAGCAGTAGG + Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1113197377 13:107824176-107824198 ACAATTTAGTGGAAAGCAGATGG - Intronic
1113869751 13:113551912-113551934 GCATGTCACTAGAAAGAAGTGGG + Intronic
1115405890 14:33015911-33015933 ATATTTGAGTAGAAAGCACTTGG + Intronic
1115907792 14:38220461-38220483 AAATTTTACTGGAAAATAGTAGG + Intergenic
1116500015 14:45609117-45609139 ATATTTTACTAGAAATTAGTGGG - Intergenic
1117326651 14:54675063-54675085 AGATTTTAAAAGAAAGCAGAAGG + Intronic
1117666740 14:58063507-58063529 ACATTTTATTAAAGATCAGTAGG + Intronic
1119518325 14:75266081-75266103 ACATTTATTTAGAAAGCATTTGG - Intronic
1119706206 14:76784169-76784191 CCATTTTCTTAGAAAGCAGAAGG + Intergenic
1120087582 14:80292129-80292151 AAATTTTACAAAATAGCAGTAGG - Intronic
1123151478 14:106185782-106185804 ACATCTTAATAGTAAGCAGCTGG - Intergenic
1123399875 15:19973665-19973687 ACATCTTAATAGTAAGCAGCTGG - Intergenic
1135232046 16:20717688-20717710 AGATTTTTCTAAAAAGCACTTGG + Intronic
1135997156 16:27259122-27259144 ATATTTTTCTAGCAGGCAGTTGG - Intronic
1138699524 16:58847254-58847276 GCTTTGTACTAGAAAGCACTAGG - Intergenic
1140310996 16:73848171-73848193 ACATTTCCCTAAATAGCAGTTGG + Intergenic
1142439588 16:90087730-90087752 AAATTTTACAAGAAAACACTGGG + Intronic
1143236496 17:5405974-5405996 ACATTTTAGAAGAAAGGATTTGG - Intronic
1145294798 17:21579437-21579459 ACAATTTACAAGTACGCAGTGGG - Intergenic
1148123958 17:45227453-45227475 ACATTCTAATAGAAAGATGTGGG + Intronic
1150843672 17:68633423-68633445 ACATCTTACTAGAAAACAAGAGG + Intergenic
1203170959 17_GL000205v2_random:147568-147590 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1152957982 18:55931-55953 AAATTTTACAAGAAAACACTGGG - Intronic
1154091367 18:11366811-11366833 ACATTTTATTTGAAAGCAGTTGG + Intergenic
1155625842 18:27833710-27833732 ACATTTTTCTAGAAGACAGAGGG - Intergenic
1155953601 18:31938541-31938563 AGATTTTAGTAGAAAACACTTGG - Intronic
1156041314 18:32826159-32826181 ACTGTTTAATAGAGAGCAGTCGG - Intergenic
1156190828 18:34718571-34718593 ACGTCTTATTAGAAAACAGTGGG - Intronic
1157250114 18:46087975-46087997 ACTTTTTAATACAAATCAGTAGG - Intronic
1158516580 18:58135635-58135657 GGAATTTACTAGAAAGAAGTCGG - Intronic
1158640549 18:59199973-59199995 ACATTGTAATACAAAGAAGTGGG + Intergenic
1159087071 18:63805038-63805060 ACTTATTTCTAGAAAGCAGCAGG - Exonic
1159218869 18:65433480-65433502 GCAGTTTTCTAAAAAGCAGTGGG + Intergenic
1159326416 18:66925116-66925138 ACATTTTACTATCAAGCCATTGG + Intergenic
1159337951 18:67094699-67094721 ACATTTAAGCAAAAAGCAGTTGG + Intergenic
1159795551 18:72838584-72838606 AAATTTTTCTAGTAAGAAGTGGG + Intronic
1159858084 18:73613393-73613415 AGATTTGACTAGAAATCAGAGGG + Intergenic
1160136444 18:76275427-76275449 AGATTTTTCTTTAAAGCAGTGGG + Intergenic
1163078118 19:14914611-14914633 TCATACTACTAGAAAGGAGTGGG - Intergenic
1166086950 19:40482634-40482656 ACATTTTTATAAAACGCAGTCGG + Intronic
1166605056 19:44134506-44134528 ACATAGTACTAGAAAACTGTTGG + Exonic
1166865965 19:45837692-45837714 AAATTTTACTTGAAGGAAGTTGG + Intronic
926414384 2:12634593-12634615 ACATTTAAGTAGAAATGAGTAGG + Intergenic
927304839 2:21559100-21559122 TCATTTTACTAGGGATCAGTAGG - Intergenic
929896252 2:45963225-45963247 ACATGTTCCCAGAAAGCAGAGGG - Intronic
930385377 2:50688049-50688071 ACATTCTACTATAAAGGAGAAGG - Intronic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
931819775 2:65939937-65939959 ACACTTCACTAGAAAGCTGCAGG + Intergenic
932220129 2:69992921-69992943 ACAGTCTAGTAGAAGGCAGTGGG - Intergenic
932528128 2:72495156-72495178 ACAGTTTACTAGAAAATGGTAGG - Intronic
933251549 2:80034795-80034817 ACATTCTCATAGAATGCAGTGGG + Intronic
933298798 2:80520266-80520288 ACATTTTTGGAGAAAGCTGTTGG + Intronic
935405452 2:102704623-102704645 ACAGTTTGCGAGAAAGCATTAGG + Exonic
935461642 2:103342769-103342791 ACATTTTACTAGAAGTCATAGGG - Intergenic
936259796 2:110948963-110948985 ACATTTCACTACAGACCAGTAGG + Intronic
936453070 2:112647672-112647694 ACATAATTCCAGAAAGCAGTGGG - Exonic
936688589 2:114858500-114858522 ACACTTCACTAGAAATCTGTTGG - Intronic
937831389 2:126428276-126428298 TCTTTTTAATAGAAAGCATTAGG - Intergenic
938890504 2:135700003-135700025 CCATTTTTCTATAAATCAGTCGG + Intronic
940268438 2:151865076-151865098 GCATTTGAATAGAAAACAGTAGG + Intronic
940540215 2:155005329-155005351 ACACTATACTAGAAAGAAGACGG + Intergenic
941413794 2:165193560-165193582 ACATGGTACCAGCAAGCAGTAGG - Intronic
942637490 2:178023514-178023536 AAATTTTACTATAAAGTATTGGG - Intronic
942670672 2:178373063-178373085 ACATTTTACTAGAAATCTATAGG + Intronic
942950392 2:181714530-181714552 GGATTTTACTTGAAAGCACTAGG + Intergenic
943123116 2:183762412-183762434 ACATTTTATTTGCAGGCAGTAGG - Intergenic
943163833 2:184290692-184290714 TCAATTTATTAGAAAACAGTTGG + Intergenic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
944652649 2:201847184-201847206 CCATTTTAATAAAAAGCTGTGGG + Intronic
945499036 2:210545635-210545657 ATATGTTATTAGAAAGCACTTGG + Intronic
945898811 2:215515217-215515239 AAACTTTAGTTGAAAGCAGTAGG - Intergenic
946091369 2:217226705-217226727 ACATTTAGCAAGAAAGGAGTAGG + Intergenic
1169526676 20:6435607-6435629 GCTTTTTAGTAGACAGCAGTTGG + Intergenic
1169546184 20:6653253-6653275 ACATATTTCTAGGAAGCACTTGG - Intergenic
1170745324 20:19093648-19093670 ACATCTTAAAAGAAAGAAGTGGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1173056171 20:39615577-39615599 ACACTTCACTAGTAAACAGTAGG - Intergenic
1173574927 20:44106678-44106700 ACATCTTACTAGATGGCAGCAGG + Intergenic
1176326943 21:5509399-5509421 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1176330763 21:5546812-5546834 ACATCTCACCAGAAAGCAGTGGG + Intergenic
1176396994 21:6274139-6274161 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1176400814 21:6311552-6311574 ACATCTCACCAGAAAGCAGTGGG + Intergenic
1176436343 21:6677552-6677574 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1176440163 21:6714965-6714987 ACATCTCACCAGAAAGCAGTGGG + Intergenic
1176460605 21:7004622-7004644 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1176464425 21:7042034-7042056 ACATCTCACCAGAAAGCAGTGGG + Intergenic
1176484166 21:7386400-7386422 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1176487986 21:7423813-7423835 ACATCTCACCAGAAAGCAGTGGG + Intergenic
1178572731 21:33755582-33755604 CCATTTTACCACAAAGCAATGGG - Intronic
1180152286 21:45956010-45956032 ACATTTTACTAGTAACCTTTGGG - Intergenic
1182787128 22:32917442-32917464 ACCTTTTACTAAAAGGCTGTTGG - Intronic
1184780522 22:46646890-46646912 ACATCTTACCAGATAGCAGCAGG + Intronic
949256012 3:2046914-2046936 CCATTTGACTTGAAAGCATTGGG - Intergenic
950130626 3:10543491-10543513 ACAATTTACTTGAAGGTAGTTGG - Intronic
951805321 3:26637300-26637322 TAATTTTTCTAGAAACCAGTTGG - Intronic
951820148 3:26799378-26799400 ACAAGTGACTAGAAAACAGTAGG - Intergenic
952148457 3:30559701-30559723 ACATTTTGGGAGAAAGCAATAGG - Intergenic
955569133 3:60285080-60285102 ACATTTTGTTAAAAAGGAGTTGG - Intronic
955699363 3:61668495-61668517 CCATTTTAGTAGAAAGCAAACGG + Intronic
956268151 3:67421407-67421429 ACATTTCACTAGCAGTCAGTTGG + Intronic
957080402 3:75631806-75631828 ACATCCCACCAGAAAGCAGTGGG + Intergenic
958097271 3:88962996-88963018 GCATTTTATTAGAGAGCTGTTGG + Intergenic
958516135 3:95118281-95118303 ACATTGTACTAGAAAGTCCTTGG - Intergenic
958935794 3:100254162-100254184 ACATAATACTTGAAAGCAGCTGG + Intergenic
959550395 3:107649380-107649402 ACTTTTTAATTGAAAGCATTTGG + Intronic
959569109 3:107863525-107863547 ACATTATAATGGAAAGCACTTGG + Intergenic
962919810 3:139940325-139940347 TCATCTAACTAGGAAGCAGTAGG - Intronic
963951978 3:151212311-151212333 ACATTTTTCTGGAAAACAGACGG - Exonic
965235834 3:166120804-166120826 ATAGTTTACTAGAAATCAGAAGG + Intergenic
966054457 3:175666783-175666805 ACATTTTAATACAAATGAGTGGG + Intronic
968853249 4:3098847-3098869 AACTTTTGGTAGAAAGCAGTGGG + Intronic
970269438 4:14328472-14328494 ACTTTTTATTACAAAGCACTAGG + Intergenic
970534736 4:17019304-17019326 GGATTTTATTAGAATGCAGTAGG + Intergenic
970935733 4:21567866-21567888 ACATTTTTCTAGGTACCAGTGGG + Intronic
971569035 4:28185945-28185967 ACACATTACTAGAAAAAAGTCGG - Intergenic
971574867 4:28259475-28259497 ACATTTGGCTAGAAAGCAACAGG + Intergenic
971747077 4:30596239-30596261 ACATTTTACTGGGGAACAGTGGG - Intergenic
972054933 4:34789633-34789655 AGATATTCCTGGAAAGCAGTTGG + Intergenic
973017603 4:45160742-45160764 AAATTTCACTAGAAAGAACTTGG - Intergenic
973868238 4:55136440-55136462 ATATTTTTCTAGGAAGCAGGGGG + Intergenic
975101415 4:70517680-70517702 ACATTTTACCATGAAGCTGTGGG - Intergenic
975836675 4:78429711-78429733 ACATTTTACTAATAAACAGTAGG + Intronic
976438175 4:85043176-85043198 ACATTTTAATAAAGAGCAATGGG + Intergenic
977760358 4:100728139-100728161 ATATTCTAATAGAAAACAGTGGG + Intronic
978632661 4:110765225-110765247 AGATTATAATAGAAATCAGTAGG + Intergenic
978654340 4:111048820-111048842 ACATTTTACTAAAGAGCCCTGGG + Intergenic
979479269 4:121197080-121197102 AAAATCAACTAGAAAGCAGTGGG + Intronic
979736854 4:124097173-124097195 ACATATGACTAGAAAACAGTTGG - Intergenic
979819642 4:125154820-125154842 GCAACTTACAAGAAAGCAGTAGG - Intergenic
980736176 4:136892054-136892076 ACATTTTCCATGAAAGAAGTAGG + Intergenic
982885147 4:160769642-160769664 ATATTTTATTAGAAAGTACTTGG - Intergenic
982974166 4:162032066-162032088 ACATATTCCTAGATAGTAGTTGG + Intronic
983988048 4:174083995-174084017 AGACTTTACTGGGAAGCAGTAGG - Intergenic
984536034 4:180976697-180976719 ACATTTTACAAAAAAGCTATAGG + Intergenic
984689480 4:182708947-182708969 ACATTTTACTAGAAAGCAGTGGG + Intronic
985278723 4:188266328-188266350 CCAGTTTACCAGAAAGCTGTTGG + Intergenic
985382270 4:189406912-189406934 ACATTTTACTCTACAGAAGTTGG - Intergenic
985450517 4:190059409-190059431 ACATCCCACCAGAAAGCAGTGGG - Intergenic
986246224 5:6009373-6009395 ACAATTTATTAGAAATCAGAAGG - Intergenic
987205336 5:15619489-15619511 ACATAGTTCTAGAAAACAGTGGG - Intronic
987437390 5:17912399-17912421 GCATTCTATTAGAAAGCAGGTGG + Intergenic
988424454 5:31047496-31047518 ACATGTTTCTGGAAACCAGTTGG - Intergenic
989463869 5:41731539-41731561 ACATTTTAATAAAAAGCAAAAGG - Exonic
991484084 5:67115793-67115815 ACATATTATTTGTAAGCAGTGGG - Intronic
992214509 5:74512673-74512695 ATATTTTACTATAAATCAATGGG + Intergenic
992319269 5:75594868-75594890 ACATTTTACTAGTAAGGAGTGGG + Intronic
992389275 5:76315369-76315391 ACATTTTAATGGAAATTAGTTGG - Intronic
994158089 5:96525444-96525466 ACATTTTAAATGAAAACAGTGGG + Intronic
994309659 5:98253962-98253984 AAATTTTTTTAAAAAGCAGTGGG - Intergenic
994537070 5:101045644-101045666 ATATTTTAGTAGAAAATAGTAGG + Intergenic
994863218 5:105226382-105226404 ACATTTTACAAGAAAGCACTGGG + Intergenic
996445476 5:123544254-123544276 ACACTTTGCAAGAAAGCAATGGG - Intronic
997370875 5:133358847-133358869 GCATTTTACTTAAAAGAAGTGGG - Intronic
997376644 5:133402119-133402141 ACATTGTGCTAGAAAGGACTGGG - Intronic
997720783 5:136077001-136077023 CCATTTTCCGAGAAAGCAGAAGG - Intergenic
997987550 5:138515061-138515083 ATAATTGACTAGAAAGCAGATGG + Intronic
999835740 5:155368989-155369011 ACATAGTACTTGAAAGTAGTAGG + Intergenic
999868180 5:155724555-155724577 AGGTTCTACAAGAAAGCAGTAGG - Intergenic
1000838576 5:166187483-166187505 AAATTTTACTAGGCAACAGTTGG + Intergenic
1001826368 5:174748882-174748904 ACCTTTTACCAGAAAGCAAAGGG - Intergenic
1001967999 5:175926892-175926914 ACATTTTTGTAGAAAGAAGAAGG + Intronic
1002249444 5:177916912-177916934 ACATTTTTGTAGAAAGAAGAAGG - Intergenic
1002891170 6:1333473-1333495 ACCTTTTCTTAGAAAGCATTTGG - Intergenic
1003232286 6:4265458-4265480 TCATTTTTTTAGAAACCAGTTGG + Intergenic
1003299855 6:4869529-4869551 ACATTTAACTAGGAGGCAGCAGG - Intronic
1007688664 6:43683226-43683248 TCATCTTACTAGAAGCCAGTGGG + Intronic
1008021858 6:46587784-46587806 ACATTTTACATGAAACCAGAAGG - Intronic
1008060450 6:46991145-46991167 GCATTTTATAAGAAGGCAGTAGG - Intergenic
1008927452 6:56901882-56901904 ACAATTTACTGGAGAGCAGAAGG + Intronic
1008981362 6:57487626-57487648 ACATTTTACTAAAAACCATATGG + Intronic
1009169454 6:60380651-60380673 ACATTTTACTAAAAACCATATGG + Intergenic
1009417691 6:63433975-63433997 ACATTTTTTTACAAAGGAGTAGG + Intergenic
1010016220 6:71107434-71107456 AGATTTCACTAGCTAGCAGTGGG + Intergenic
1011382284 6:86755593-86755615 ACATTTTAGTTGAAAGCAGCAGG - Intergenic
1012097989 6:94990498-94990520 ACATTTTTTTATAAAGCAGCAGG - Intergenic
1013384755 6:109615274-109615296 ACATTTTAATAGAAGGCAGAAGG - Intronic
1014854885 6:126387922-126387944 TCTTTTTACTAGAAGTCAGTCGG - Intergenic
1015086454 6:129298697-129298719 AAATTTAAGTAGGAAGCAGTAGG + Intronic
1015826954 6:137324062-137324084 ACATTCTACCAGAAAGGACTTGG - Intergenic
1016451879 6:144191435-144191457 ACATTTAACTATAAAGCATTAGG - Intergenic
1016698599 6:147028315-147028337 ACATTTGACTAATAAGCACTTGG + Intergenic
1018163640 6:161073033-161073055 ACTTTTTACCACAAAGCAGGTGG - Intronic
1018362882 6:163089206-163089228 ATATTTTAATAGAAAGCATCAGG - Intronic
1021961892 7:25881319-25881341 AAATCTTACTGGAAAGCAGGAGG - Intergenic
1022176791 7:27878798-27878820 TCATTTTAAAAGAGAGCAGTAGG + Intronic
1023520558 7:41046316-41046338 ACATATTACGAGAGAGCAATGGG + Intergenic
1023694218 7:42828206-42828228 AGCATTTTCTAGAAAGCAGTAGG + Intergenic
1023958462 7:44906902-44906924 ACATGTTAGTAGAAAGTAGAAGG - Intergenic
1028293227 7:89093994-89094016 ACATTTAACTAGCTAACAGTAGG - Intronic
1028330247 7:89581378-89581400 AAATTTTATTAGAAAGGAGGAGG - Intergenic
1029167190 7:98600706-98600728 ATTTTGTATTAGAAAGCAGTGGG + Intergenic
1031022283 7:116641157-116641179 TGATTTTACTAGGTAGCAGTTGG - Intergenic
1031876079 7:127142291-127142313 TTATTTTACTAGCATGCAGTTGG + Intronic
1032674172 7:134113223-134113245 ATATTTTTTTAAAAAGCAGTAGG + Intergenic
1033307891 7:140238544-140238566 AGATATAAATAGAAAGCAGTGGG - Intergenic
1033722573 7:144077273-144077295 CCATTTTACCAGAAAGAAGGAGG + Intergenic
1036055242 8:5244878-5244900 ACCATTTACAAGAAAGGAGTCGG - Intergenic
1039673594 8:39633720-39633742 AAATTTTACTATAAATAAGTAGG - Intronic
1039780423 8:40779684-40779706 CCATTTTCCTAGGAAGCACTGGG - Intronic
1040603455 8:48907115-48907137 ACATTTTACACAAAGGCAGTAGG - Intergenic
1040960851 8:53031426-53031448 ACATTAGACTAGAAAGTTGTTGG + Intergenic
1042023401 8:64396330-64396352 ACATTGTGCTAGAAAAAAGTAGG + Intergenic
1043363641 8:79504751-79504773 ACTTTTTATTTGAAGGCAGTAGG - Intergenic
1043812645 8:84760613-84760635 ACATTTTATTAGAAATTAGTTGG + Intronic
1044072847 8:87784279-87784301 ACATCTTACTGGAAAGCAGCAGG + Intergenic
1044367191 8:91362006-91362028 ACATTAAATGAGAAAGCAGTGGG + Intronic
1045884709 8:107081827-107081849 GAATTTTACAAGAAAGGAGTGGG - Intergenic
1045904804 8:107332123-107332145 CCATTGTTTTAGAAAGCAGTAGG + Intronic
1046127406 8:109927593-109927615 TCATTTAATTTGAAAGCAGTTGG + Intergenic
1046437874 8:114216931-114216953 ACTTATTGCTAGAGAGCAGTGGG - Intergenic
1046446392 8:114325917-114325939 ACATTGTGCTTGAAGGCAGTTGG + Intergenic
1046611733 8:116433135-116433157 TCCCTTTACTACAAAGCAGTTGG - Intergenic
1048221465 8:132545980-132546002 ACAAGAGACTAGAAAGCAGTAGG - Intergenic
1048765095 8:137835026-137835048 ACATTTCACCAGAAACCAGGGGG - Intergenic
1048773592 8:137921207-137921229 ACATTTAACAAGAAAGCCATTGG + Intergenic
1050036772 9:1444765-1444787 TCATTTGAGTTGAAAGCAGTTGG - Intergenic
1050345118 9:4678919-4678941 ACATTTTACAAGGAAGAAGTAGG - Intergenic
1050419752 9:5450953-5450975 TCATGTTACTAGCAAGCAGCTGG - Intronic
1050552448 9:6759393-6759415 ATTTTTTATTAGGAAGCAGTCGG + Intronic
1054893506 9:70279954-70279976 ACAGTTTAAGAGAAAGCAATTGG - Intronic
1055362272 9:75505417-75505439 ACAATTTTCTAGAATGCAATGGG + Intergenic
1056725467 9:89110874-89110896 ACATTGTAGAAGAAAGCAGTTGG - Intronic
1057975941 9:99606353-99606375 AAATCTTACAAGAAAACAGTGGG + Intergenic
1058297890 9:103331867-103331889 ACATTTTACTGGAAAACAAATGG + Intergenic
1059234979 9:112753228-112753250 GCATTTTACTAATAAGCACTTGG + Intronic
1060387356 9:123243680-123243702 ACATTTCACTGAAAAGCAGATGG + Intronic
1060881443 9:127120981-127121003 GCTTTCTCCTAGAAAGCAGTAGG + Intronic
1061734000 9:132639855-132639877 ATATTGAAATAGAAAGCAGTAGG - Intronic
1062740187 9:138168671-138168693 AAATTTTACAAGAAAACACTGGG + Intergenic
1203431332 Un_GL000195v1:93514-93536 ACATCTCACCAGAAAGCAGTGGG - Intergenic
1203435172 Un_GL000195v1:131109-131131 ACATCTCACCAGAAAGCAGTGGG + Intergenic
1185842644 X:3407304-3407326 ACTTTTTCCTAGAAAACAGATGG - Intergenic
1186044961 X:5525831-5525853 ACACTTTACTGGAAAGCACCAGG - Intergenic
1187677257 X:21728660-21728682 ACATTTTTTAAGAATGCAGTGGG + Intronic
1187761367 X:22589685-22589707 ACATTTTAAAAGAAAGGAGAAGG - Intergenic
1188085656 X:25898598-25898620 ACATCTTTCCAGAAAGCCGTGGG - Intergenic
1189016308 X:37288140-37288162 AAATTCAACTAGGAAGCAGTAGG - Intergenic
1189696149 X:43665233-43665255 ACATTTTTTTAAAAAGCAGAGGG + Intronic
1189730946 X:44020318-44020340 ACATTTTGTTGGAAAGCACTTGG + Intergenic
1191871609 X:65751095-65751117 ACATGTTGCAAGAAAGCAATGGG - Intergenic
1194214709 X:91115495-91115517 ACATTTTACACAAAAGCAGAAGG + Intergenic
1195615383 X:106907782-106907804 ACATTTTACTACCAAAAAGTAGG - Intronic
1196533040 X:116812294-116812316 ACATTTTTCTAAACTGCAGTTGG + Intergenic
1198019179 X:132641832-132641854 ACATTTGAGTAGGAGGCAGTTGG + Intronic
1199519691 X:148721680-148721702 ACATTGTACTACAAACCAGGTGG + Intronic
1201781872 Y:17731695-17731717 AGAATTTACTAGAAAGCAATTGG - Intergenic
1201819681 Y:18174295-18174317 AGAATTTACTAGAAAGCAATTGG + Intergenic