ID: 984693297

View in Genome Browser
Species Human (GRCh38)
Location 4:182753335-182753357
Sequence CCAGTGACAACACGGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984693297_984693304 4 Left 984693297 4:182753335-182753357 CCTGTCACCCGTGTTGTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 984693304 4:182753362-182753384 AAATAACTGAGTTTAATAATGGG 0: 1
1: 0
2: 15
3: 102
4: 947
984693297_984693303 3 Left 984693297 4:182753335-182753357 CCTGTCACCCGTGTTGTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 984693303 4:182753361-182753383 TAAATAACTGAGTTTAATAATGG 0: 1
1: 0
2: 6
3: 74
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984693297 Original CRISPR CCAGTGACAACACGGGTGAC AGG (reversed) Intronic
902870180 1:19309323-19309345 CAAGTGTGAACACAGGTGACCGG - Intronic
905386996 1:37611921-37611943 CCTGTGACAACACTGCTGCCGGG + Exonic
907186282 1:52611855-52611877 CCAGTGAGAAAACGGAGGACAGG - Intergenic
908892265 1:68861124-68861146 CCAGTGACAAGATGGAAGACTGG - Intergenic
914787365 1:150846546-150846568 CTAATGACAACACAGCTGACTGG + Intronic
920817347 1:209346969-209346991 CAAGTGACAACTCGGGGCACTGG - Intergenic
1068053896 10:51986034-51986056 CCGGTGACAGCATGGCTGACTGG + Intronic
1070447908 10:76525896-76525918 CCAGGGACAAGATGAGTGACAGG - Intronic
1070837226 10:79456929-79456951 CCAGGGACAGCACGGGTGATGGG - Intergenic
1074515214 10:114161068-114161090 ACAGTGACAGCACGGGTGAGTGG - Intronic
1079708900 11:23655735-23655757 CCTGTTAAAACACGGTTGACCGG + Intergenic
1081330357 11:41793197-41793219 CCAGTGACAAGATGGAAGACTGG + Intergenic
1082749368 11:57000487-57000509 CCAATGACAAGACGGGAGGCTGG - Intergenic
1083167663 11:60901011-60901033 CCCCTGAGAACATGGGTGACTGG - Intronic
1083203275 11:61132556-61132578 CCAGTGACAACAGGGGCAGCTGG + Intronic
1086354107 11:85974877-85974899 ACAATGACAACAGGGATGACAGG + Intronic
1087471333 11:98579000-98579022 CCAGTGAGAACACCGGTACCAGG - Intergenic
1097441289 12:59611937-59611959 CCAGTGAAAGCACCTGTGACAGG - Intronic
1102469410 12:113151131-113151153 CCAGTGCCTACAAGGGTGCCTGG + Intronic
1109262818 13:60163936-60163958 CCCGGGCCAACACGGGTGGCGGG - Exonic
1113932890 13:113977570-113977592 CAAGTGACATCTCTGGTGACAGG - Intergenic
1121526167 14:94620979-94621001 CCAGTGAAAACAGGGGTGGTGGG - Intronic
1121612749 14:95292832-95292854 CCTGTGAGAGCACGGGTGCCCGG + Intronic
1132661116 16:1061975-1061997 CCAGGAACACCACGGGTGGCTGG + Intergenic
1134243718 16:12524303-12524325 CCAGTGACCACACAGGTCAGCGG - Intronic
1137317010 16:47336399-47336421 GCAGTGACAACACTGGTCCCTGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1142404354 16:89879056-89879078 ACACAGACAGCACGGGTGACAGG - Intronic
1142404359 16:89879098-89879120 ACACGGACAACACGTGTGACAGG - Intronic
1142404381 16:89879224-89879246 ACACGGACAACACGTGTGACAGG - Intronic
1142404388 16:89879266-89879288 ACACGGACAACACGTGTGACAGG - Intronic
1142404403 16:89879392-89879414 ACACGGACAACACGTGTGACAGG - Intronic
1142404410 16:89879434-89879456 ACACGGACAACACGTGTGACAGG - Intronic
1142404417 16:89879476-89879498 ACACGGACAACACGTGTGACAGG - Intronic
1142404424 16:89879518-89879540 ACACGGACAACACGTGTGACAGG - Intronic
1142404431 16:89879560-89879582 ACACGGACAACACGTGTGACAGG - Intronic
1142404438 16:89879602-89879624 ACACGGACAACACGTGTGACAGG - Intronic
1142404445 16:89879644-89879666 ACACGGACAACACGTGTGACAGG - Intronic
1142404452 16:89879686-89879708 ACACGGACAACACGTGTGACAGG - Intronic
1142404459 16:89879728-89879750 ACACGGACAACACGTGTGACAGG - Intronic
1142404466 16:89879770-89879792 ACACGGACAACACGTGTGACAGG - Intronic
1142404473 16:89879812-89879834 ACACGGACAACACGTGTGACAGG - Intronic
1142404480 16:89879854-89879876 ACACGGACAACACGTGTGACAGG - Intronic
1142404485 16:89879896-89879918 ACACGGACAACACGTGTGACAGG - Intronic
1142404505 16:89880064-89880086 ACATGGACAACACGTGTGACAGG - Intronic
1142679032 17:1534807-1534829 CCAGGGACACCACATGTGACAGG - Intronic
1145788721 17:27611006-27611028 CCAGATACAGCACAGGTGACCGG - Intronic
1146257751 17:31401369-31401391 GCAGTGACCTCAGGGGTGACAGG - Intronic
1149813388 17:59699977-59699999 CCCGTGATCACATGGGTGACTGG + Exonic
1150384974 17:64751486-64751508 CCAGTGACAGCAGGTGTCACGGG + Intergenic
1151447197 17:74175037-74175059 CCAGTGTCAAGACGGGAGGCTGG + Intergenic
1155400160 18:25429268-25429290 CCAGTGGGAACAGGGGTGAGGGG + Intergenic
1159914925 18:74180353-74180375 CCAGGGACACCAAGGGTGCCTGG + Intergenic
1160787268 19:906739-906761 CCGGGGACAGCACAGGTGACAGG - Intronic
1165373620 19:35426051-35426073 CCAGTGACCACACAAGGGACAGG - Intergenic
1168225311 19:54990465-54990487 CAAATGGCAACACGGTTGACAGG - Intronic
1168241523 19:55091388-55091410 CCCGTGTGAACACGAGTGACAGG - Exonic
925287400 2:2724782-2724804 CCAGAGACAGGACTGGTGACGGG - Intergenic
927856022 2:26528452-26528474 CCAGTGGTAACACTGGGGACAGG + Intronic
931365859 2:61618206-61618228 CTGGTGACAACATGGGGGACAGG - Intergenic
935782695 2:106521876-106521898 CCTGTGAAAACACTGGTGTCTGG + Intergenic
941041882 2:160632566-160632588 GCATTGACAACAGAGGTGACAGG - Intergenic
943903651 2:193472024-193472046 CCAGTGATAACATGGGAGAATGG + Intergenic
1170968015 20:21093538-21093560 CCAATCACAACACAGGAGACTGG + Intergenic
1175597625 20:60247892-60247914 CCAGTGACAAAGAGGGTGAGAGG - Intergenic
1176385703 21:6137737-6137759 CCAGTCACACCACTGGGGACCGG - Intergenic
1179737770 21:43400515-43400537 CCAGTCACACCACTGGGGACCGG + Intergenic
1181732231 22:24855565-24855587 CCAGTGGCAGCATGGATGACCGG + Exonic
1183188143 22:36304241-36304263 CCAGTGAGAAGAAGGGTGAAGGG - Intronic
1185403263 22:50629495-50629517 CCAGTGGCAAGACCGGTTACAGG - Intergenic
1185404530 22:50640099-50640121 CCAGTGGCAAGACCGGTTACAGG - Intergenic
949502984 3:4699814-4699836 CCTGTAACAACACTAGTGACAGG + Exonic
950177334 3:10884029-10884051 CCAATGACAACAGTGGTGCCGGG + Intronic
951634486 3:24757722-24757744 CCAGTGAAAATACTGATGACTGG + Intergenic
966817926 3:183904511-183904533 CCTGTGAGACCAGGGGTGACAGG - Intergenic
968634047 4:1668612-1668634 CCTGTGACAGCACGGGGGAGGGG + Intronic
976691934 4:87877390-87877412 CCACTGACACCACGGGTCAGTGG - Intergenic
984693297 4:182753335-182753357 CCAGTGACAACACGGGTGACAGG - Intronic
985754461 5:1704844-1704866 GCAGTGAGTACACGGGGGACGGG - Intergenic
986364932 5:7020532-7020554 CCAGTGACAAGATGGAAGACAGG - Intergenic
989350258 5:40478044-40478066 CCAGTGCCAACAGGGGAGAGTGG - Intergenic
998116750 5:139543549-139543571 CCGGCGACGACACGGGGGACCGG + Intronic
1001596925 5:172904527-172904549 CCACTGCCCACACTGGTGACAGG + Intronic
1004823617 6:19396948-19396970 CCAGTGAACACACGAATGACAGG - Intergenic
1007740952 6:44009201-44009223 ACAGTGACAAAAAGAGTGACAGG + Intergenic
1007839547 6:44704541-44704563 CCAGTGCCACCACGGTGGACAGG - Intergenic
1012157390 6:95836779-95836801 CCAATGAAAACACTGGTGACTGG + Intergenic
1012551225 6:100466081-100466103 TCAGTGAGAACACCAGTGACGGG + Intergenic
1016043473 6:139456810-139456832 CCAGTGATCACACAAGTGACTGG - Intergenic
1026473704 7:70716214-70716236 CCTGTGAGAACACTGGTGACTGG + Intronic
1032917778 7:136511243-136511265 CCAGTGACAAGATGGGAGAATGG - Intergenic
1036953520 8:13163509-13163531 CCTGTGACAACACCAGTCACAGG + Intronic
1038809996 8:30830706-30830728 CCAATGACAACACTGTTGACAGG + Intergenic
1040549555 8:48427837-48427859 CCAGGGCTACCACGGGTGACGGG - Intergenic
1044198676 8:89408981-89409003 CCAGTGACCACATGGCTGATTGG + Intergenic
1049497924 8:142945389-142945411 CCAGTGTCCACACGGGTGGGCGG - Intergenic
1055375635 9:75646438-75646460 CCAGTGACAAGATGGGAGAATGG - Intergenic
1062024435 9:134333764-134333786 GCAGTGACAGCACAGGTGGCTGG + Intronic
1186768980 X:12798909-12798931 GCTGTGACAACACGTGTGAAGGG - Intronic
1195980164 X:110568810-110568832 GCAGTGACAACAGTGCTGACAGG - Intergenic
1199502348 X:148521232-148521254 CCTGTGACAACACAGAGGACTGG + Intronic
1201456058 Y:14167800-14167822 CCCATGACAACATGGGTGTCCGG - Intergenic